Miyakogusa Predicted Gene

Lj0g3v0349529.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj0g3v0349529.1 tr|I1LXJ9|I1LXJ9_SOYBN Lipase OS=Glycine max PE=3
SV=1,76.47,0,alpha/beta-Hydrolases,NULL; Abhydro_lipase,Partial
AB-hydrolase lipase domain; Abhydrolase_1,Alpha/b,gene.g27386.t1.1
         (1218 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC77168 similar to UniRef100_A7PXA3 Cluster: Chromosome...    54   2e-06

>gnl|LJGI|TC77168 similar to UniRef100_A7PXA3 Cluster: Chromosome chr12 scaffold_36,
           whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
           Chromosome chr12 scaffold_36, whole genome shotgun
           sequence - Vitis vinifera (Grape), partial (51%)
          Length = 818

 Score = 54.0 bits (27), Expect = 2e-06
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                      
Query: 426 ttattggaattggtcatgggatgaatt 452
           |||||||||||||||||||||||||||
Sbjct: 446 ttattggaattggtcatgggatgaatt 472