Miyakogusa Predicted Gene

Lj0g3v0349359.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj0g3v0349359.1 Non Chatacterized Hit- tr|I1J738|I1J738_SOYBN
Uncharacterized protein OS=Glycine max PE=4 SV=1,81.43,0,SANT  SWI3,
ADA2, N-CoR and TFIIIB'' DNA-bin,SANT/Myb domain;
Homeodomain-like,Homeodomain-like; HTH,CUFF.23997.1
         (1059 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|BW631642 similar to UniRef100_A0FK20 Cluster: Myb trans...    74   2e-12

>gnl|LJGI|BW631642 similar to UniRef100_A0FK20 Cluster: Myb transcription factor; n=1;
           Malus x domestica|Rep: Myb transcription factor - Malus
           domestica (Apple) (Malus sylvestris), partial (19%)
          Length = 474

 Score = 73.8 bits (37), Expect = 2e-12
 Identities = 130/161 (80%)
 Strand = Plus / Plus

                                                                       
Query: 166 tggagcctcatcgctcgcgggatcgccggaagatccggcaagtcttgccgcctccggtgg 225
           |||||| | ||||| || |||||  |||| || ||||| ||||| ||||| |||||||||
Sbjct: 314 tggagcatgatcgcgcgggggattcccgggaggtccgggaagtcgtgccggctccggtgg 373

                                                                       
Query: 226 tgcaatcagctcgacccttccgtcaagcgcaagcccttcaccgatgaggaggatcggatt 285
           || |||||||| ||||||| ||| || || |||||||| || || || |||||  || | 
Sbjct: 374 tgtaatcagcttgacccttgcgtgaaacggaagccctttactgaggaagaggacaggctc 433

                                                    
Query: 286 atagttgctgctcatgcaatccatgggaacaaatgggcagc 326
           ||| || | || |||||||||||||| |||| |||||||||
Sbjct: 434 ataatttcagcccatgcaatccatggaaacagatgggcagc 474