Miyakogusa Predicted Gene

Lj0g3v0344029.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj0g3v0344029.1 Non Chatacterized Hit- tr|F6HNL7|F6HNL7_VITVI
Putative uncharacterized protein OS=Vitis vinifera
GN=,44.44,0.000000001, ,NODE_15952_length_769_cov_210.232773.path1.1
         (319 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC72699 similar to UniRef100_A8IPW4 Cluster: Predicted ...   488   e-137

>gnl|LJGI|TC72699 similar to UniRef100_A8IPW4 Cluster: Predicted protein; n=1;
           Chlamydomonas reinhardtii|Rep: Predicted protein -
           Chlamydomonas reinhardtii, partial (5%)
          Length = 600

 Score =  488 bits (246), Expect = e-137
 Identities = 246/246 (100%)
 Strand = Plus / Plus

                                                                       
Query: 74  acaggattgctgcccgggagaagattaagcgccgtggtgacagttatcagccagcaattg 133
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 12  acaggattgctgcccgggagaagattaagcgccgtggtgacagttatcagccagcaattg 71

                                                                       
Query: 134 acaacttggcaaatgattcagcatacatgttgaatttgtcttcagcttctgatctggaca 193
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 72  acaacttggcaaatgattcagcatacatgttgaatttgtcttcagcttctgatctggaca 131

                                                                       
Query: 194 aatctgcagaagttgctaaatctcttaccttttcttcaggttttctgggatcacatggaa 253
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 132 aatctgcagaagttgctaaatctcttaccttttcttcaggttttctgggatcacatggaa 191

                                                                       
Query: 254 atcttacggttccttcaagtcttgggtcgggtgggaaatttcctgccctggtgtcacctc 313
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 192 atcttacggttccttcaagtcttgggtcgggtgggaaatttcctgccctggtgtcacctc 251

                 
Query: 314 tttttt 319
           ||||||
Sbjct: 252 tttttt 257