Miyakogusa Predicted Gene

Lj0g3v0343309.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj0g3v0343309.1 Non Chatacterized Hit- tr|Q9SUN6|Q9SUN6_ARATH
Putative serine proteinase OS=Arabidopsis thaliana
GN=,42.11,1e-18,Inhibitor_I9,Proteinase inhibitor I9,CUFF.23540.1
         (432 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC66797                                                      305   1e-82

>gnl|LJGI|TC66797 
          Length = 610

 Score =  305 bits (154), Expect = 1e-82
 Identities = 199/214 (92%)
 Strand = Plus / Plus

                                                                       
Query: 1   atgggaaactcatatttggcacatttggtggttatgttgagtttcttggggatgctacta 60
           ||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||
Sbjct: 79  atggggaactcatatttggcacatttggtggttttgttgagtttcttggggatgctacta 138

                                                                       
Query: 61  ataccttcctcatgtcaagatgattcaaatgaatatgatgcaactactgctgtgtacatt 120
           | ||||||||||||||||||||||||  ||||||||||||||||||||||||| ||||||
Sbjct: 139 acaccttcctcatgtcaagatgattcggatgaatatgatgcaactactgctgtctacatt 198

                                                                       
Query: 121 gttactctcagacaagcccctacttctcataatcaggaagagctgaccagagaaattggt 180
           |||||||||| |||||||||||| ||||| |||||||| | | ||||||||| |||||||
Sbjct: 199 gttactctcaaacaagcccctacgtctcacaatcaggatgcgttgaccagagtaattggt 258

                                             
Query: 181 caccacttcagacatggtgcttctaggagaaata 214
           |||||||||||| |||||| ||||||||||||||
Sbjct: 259 caccacttcagaaatggtgtttctaggagaaata 292