Miyakogusa Predicted Gene

Lj0g3v0342769.1
Show Alignment: 

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj0g3v0342769.1 tr|G7LI99|G7LI99_MEDTR Lipoxygenase OS=Medicago
truncatula GN=MTR_8g018420 PE=3
SV=1,54.5,5.60519e-45,PLTLPOXGNASE,Lipoxygenase, plant;
Lipoxigenase,Lipoxygenase, C-terminal;
LIPOXYGENASE_3,Lipoxygenase,CUFF.23497.1
         (546 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC78762 similar to UniRef100_O04919 Cluster: Lipoxygena...   147   8e-35
gnl|LJGI|TC71649 similar to UniRef100_O04919 Cluster: Lipoxygena...   131   5e-30
gnl|LJGI|TC79119 similar to UniRef100_O04919 Cluster: Lipoxygena...   121   5e-27
gnl|LJGI|TC76657 similar to UniRef100_A7LCD6 Cluster: Lipoxygena...    78   6e-14
gnl|LJGI|TC81510 similar to UniRef100_O24470 Cluster: Lipoxygena...    74   1e-12
gnl|LJGI|TC64177 similar to UniRef100_O04919 Cluster: Lipoxygena...    68   6e-11
gnl|LJGI|TC57788 similar to UniRef100_O24470 Cluster: Lipoxygena...    66   2e-10
gnl|LJGI|TC64500 similar to UniRef100_Q43817 Cluster: Lipoxygena...    62   4e-09
gnl|LJGI|AV780099 similar to UniRef100_O24320 Cluster: Lipoxygen...    60   2e-08
gnl|LJGI|TC75730 similar to UniRef100_Q9M3Z5 Cluster: Lipoxygena...    58   6e-08

>gnl|LJGI|TC78762 similar to UniRef100_O04919 Cluster: Lipoxygenase; n=1; Vicia
           faba|Rep: Lipoxygenase - Vicia faba (Broad bean),
           partial (46%)
          Length = 1204

 Score =  147 bits (74), Expect = 8e-35
 Identities = 134/154 (87%)
 Strand = Plus / Plus

                                                                       
Query: 354 atttgcaagagagatcattgctggtgtaaatcctgctttaattcgttgtcttcatgagtt 413
           ||||||||||||||||||||||||||||||||||| |||| |||     ||||| |||||
Sbjct: 5   atttgcaagagagatcattgctggtgtaaatcctggtttagttcacatccttcaagagtt 64

                                                                       
Query: 414 tcctcccagaagtaagctagactatgaaatctatggggatcacacaagcacaataacaaa 473
           |||||| | |||||||||||||  || | ||||||||||||| ||||||||||| || ||
Sbjct: 65  tcctccaaaaagtaagctagacagtggagtctatggggatcatacaagcacaattaccaa 124

                                             
Query: 474 agaatatatagagcgtaacttagatgggctcact 507
           |||| | ||||||| |||||||||||||||||||
Sbjct: 125 agaacaaatagagcttaacttagatgggctcact 158


>gnl|LJGI|TC71649 similar to UniRef100_O04919 Cluster: Lipoxygenase; n=1; Vicia
           faba|Rep: Lipoxygenase - Vicia faba (Broad bean),
           partial (9%)
          Length = 489

 Score =  131 bits (66), Expect = 5e-30
 Identities = 141/166 (84%)
 Strand = Plus / Plus

                                                                       
Query: 343 actgatgtcgaatttgcaagagagatcattgctggtgtaaatcctgctttaattcgttgt 402
           |||||||  ||||||||||||||||||||||||||||||||||||| ||||  ||     
Sbjct: 127 actgatgaagaatttgcaagagagatcattgctggtgtaaatcctggtttagatcacatc 186

                                                                       
Query: 403 cttcatgagtttcctcccagaagtaagctagactatgaaatctatggggatcacacaagc 462
           ||||| ||||||||||| | |||||||||||||  |||| ||||||||||||  ||||| 
Sbjct: 187 cttcaagagtttcctccaaaaagtaagctagacagtgaagtctatggggatcgtacaaga 246

                                                         
Query: 463 acaataacaaaagaatatatagagcgtaacttagatgggctcactg 508
           |||||||| |||||| | ||||||| |||||||||  |||||||||
Sbjct: 247 acaataaccaaagaacaaatagagcttaacttagaaaggctcactg 292


>gnl|LJGI|TC79119 similar to UniRef100_O04919 Cluster: Lipoxygenase; n=1; Vicia
           faba|Rep: Lipoxygenase - Vicia faba (Broad bean),
           partial (27%)
          Length = 772

 Score =  121 bits (61), Expect = 5e-27
 Identities = 171/209 (81%), Gaps = 9/209 (4%)
 Strand = Plus / Plus

                                                                       
Query: 307 cctaaagtgattcaagagagtgaatctgaatggatgactgatgtcgaatttgcaagagag 366
           |||||||||||||||| ||   | |||| ||||||||||||||  |||||||||||||||
Sbjct: 314 cctaaagtgattcaagtgaacaagtctgcatggatgactgatgaagaatttgcaagagag 373

                                                                       
Query: 367 atcattgctggtgtaaatcctgctttaattcgttgtcttcat---------gagtttcct 417
           |||||||||||||||||||| || |||||||| |||||||||          ||||||||
Sbjct: 374 atcattgctggtgtaaatccagccttaattcgctgtcttcatcgaccagagcagtttcct 433

                                                                       
Query: 418 cccagaagtaagctagactatgaaatctatggggatcacacaagcacaataacaaaagaa 477
           || | |||||| || |||  || |  |||||| ||||| || ||||||||||| ||||||
Sbjct: 434 ccaaaaagtaaccttgacagtggatcctatggtgatcatactagcacaataaccaaagaa 493

                                        
Query: 478 tatatagagcgtaacttagatgggctcac 506
            | ||||||| ||||||||| ||||||||
Sbjct: 494 cacatagagcctaacttagacgggctcac 522


>gnl|LJGI|TC76657 similar to UniRef100_A7LCD6 Cluster: Lipoxygenase-10; n=1; Glycine
           max|Rep: Lipoxygenase-10 - Glycine max (Soybean),
           partial (24%)
          Length = 654

 Score = 77.8 bits (39), Expect = 6e-14
 Identities = 75/87 (86%)
 Strand = Plus / Plus

                                                                       
Query: 301 ccacctcctaaagtgattcaagagagtgaatctgaatggatgactgatgtcgaatttgca 360
           ||||| |||||||||||||||| || | | |||| ||||||||||||||  |||||||| 
Sbjct: 43  ccaccacctaaagtgattcaagtgaataagtctgcatggatgactgatgaagaatttgct 102

                                      
Query: 361 agagagatcattgctggtgtaaatcct 387
           || ||||| |||||||| |||||||||
Sbjct: 103 agggagatgattgctggagtaaatcct 129


>gnl|LJGI|TC81510 similar to UniRef100_O24470 Cluster: Lipoxygenase; n=1; Pisum
           sativum|Rep: Lipoxygenase - Pisum sativum (Garden pea),
           partial (38%)
          Length = 1048

 Score = 73.8 bits (37), Expect = 1e-12
 Identities = 52/57 (91%)
 Strand = Plus / Plus

                                                                    
Query: 331 tctgaatggatgactgatgtcgaatttgcaagagagatcattgctggtgtaaatcct 387
           |||| ||||||||||||||| ||||||| ||||||||| ||||||||||| ||||||
Sbjct: 251 tctgcatggatgactgatgttgaatttggaagagagatgattgctggtgttaatcct 307


>gnl|LJGI|TC64177 similar to UniRef100_O04919 Cluster: Lipoxygenase; n=1; Vicia
           faba|Rep: Lipoxygenase - Vicia faba (Broad bean),
           partial (30%)
          Length = 841

 Score = 67.9 bits (34), Expect = 6e-11
 Identities = 84/100 (84%), Gaps = 3/100 (3%)
 Strand = Plus / Plus

                                                                       
Query: 46  ccttatcctcgtaggggaagaactggcagaaaaccaacaataaaagatcataatactgag 105
           ||||| ||||||||||||||||| |||||||||||||||   | ||||| | | ||||||
Sbjct: 739 ccttaccctcgtaggggaagaacaggcagaaaaccaacagccacagatcctcaaactgag 798

                                                   
Query: 106 agcaaaagcagcacctattactatattccaagagatgaag 145
           |||| ||||||||    || ||| ||||||||||||||||
Sbjct: 799 agcagaagcagca---gtttctacattccaagagatgaag 835


>gnl|LJGI|TC57788 similar to UniRef100_O24470 Cluster: Lipoxygenase; n=1; Pisum
            sativum|Rep: Lipoxygenase - Pisum sativum (Garden pea),
            partial (96%)
          Length = 2928

 Score = 65.9 bits (33), Expect = 2e-10
 Identities = 51/57 (89%)
 Strand = Plus / Plus

                                                                     
Query: 331  tctgaatggatgactgatgtcgaatttgcaagagagatcattgctggtgtaaatcct 387
            |||| ||||||||||||||  ||||||| ||||||||| |||||||| |||||||||
Sbjct: 1169 tctgcatggatgactgatgaagaatttggaagagagatgattgctggagtaaatcct 1225


>gnl|LJGI|TC64500 similar to UniRef100_Q43817 Cluster: Lipoxygenase; n=1; Pisum
            sativum|Rep: Lipoxygenase - Pisum sativum (Garden pea),
            partial (51%)
          Length = 1431

 Score = 61.9 bits (31), Expect = 4e-09
 Identities = 73/87 (83%)
 Strand = Plus / Plus

                                                                        
Query: 301  ccacctcctaaagtgattcaagagagtgaatctgaatggatgactgatgtcgaatttgca 360
            ||||| |||||||||||||||| || | | |||| ||||||||||||||  ||||| || 
Sbjct: 1149 ccaccacctaaagtgattcaagtgaataagtctgcatggatgactgatgaagaattggct 1208

                                       
Query: 361  agagagatcattgctggtgtaaatcct 387
            || ||||| || ||||| |||||||||
Sbjct: 1209 agggagatgatggctggagtaaatcct 1235


>gnl|LJGI|AV780099 similar to UniRef100_O24320 Cluster: Lipoxygenase; n=1; Phaseolus
           vulgaris|Rep: Lipoxygenase - Phaseolus vulgaris (Kidney
           bean) (French bean), partial (17%)
          Length = 514

 Score = 60.0 bits (30), Expect = 2e-08
 Identities = 45/50 (90%)
 Strand = Plus / Minus

                                                             
Query: 338 ggatgactgatgtcgaatttgcaagagagatcattgctggtgtaaatcct 387
           ||||||||||||  ||||||| ||||||||| |||||||| |||||||||
Sbjct: 514 ggatgactgatgaagaatttggaagagagatgattgctggagtaaatcct 465


>gnl|LJGI|TC75730 similar to UniRef100_Q9M3Z5 Cluster: Lipoxygenase; n=1; Cicer
           arietinum|Rep: Lipoxygenase - Cicer arietinum (Chickpea)
           (Garbanzo), partial (93%)
          Length = 1640

 Score = 58.0 bits (29), Expect = 6e-08
 Identities = 47/53 (88%)
 Strand = Plus / Plus

                                                                
Query: 331 tctgaatggatgactgatgtcgaatttgcaagagagatcattgctggtgtaaa 383
           |||| ||||||||||||||  || |||||||||||||| ||||| ||||||||
Sbjct: 7   tctgcatggatgactgatgatgagtttgcaagagagatgattgcgggtgtaaa 59