Miyakogusa Predicted Gene
- Lj0g3v0342769.1
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj0g3v0342769.1 tr|G7LI99|G7LI99_MEDTR Lipoxygenase OS=Medicago
truncatula GN=MTR_8g018420 PE=3
SV=1,54.5,5.60519e-45,PLTLPOXGNASE,Lipoxygenase, plant;
Lipoxigenase,Lipoxygenase, C-terminal;
LIPOXYGENASE_3,Lipoxygenase,CUFF.23497.1
(546 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|TC78762 similar to UniRef100_O04919 Cluster: Lipoxygena... 147 8e-35
gnl|LJGI|TC71649 similar to UniRef100_O04919 Cluster: Lipoxygena... 131 5e-30
gnl|LJGI|TC79119 similar to UniRef100_O04919 Cluster: Lipoxygena... 121 5e-27
gnl|LJGI|TC76657 similar to UniRef100_A7LCD6 Cluster: Lipoxygena... 78 6e-14
gnl|LJGI|TC81510 similar to UniRef100_O24470 Cluster: Lipoxygena... 74 1e-12
gnl|LJGI|TC64177 similar to UniRef100_O04919 Cluster: Lipoxygena... 68 6e-11
gnl|LJGI|TC57788 similar to UniRef100_O24470 Cluster: Lipoxygena... 66 2e-10
gnl|LJGI|TC64500 similar to UniRef100_Q43817 Cluster: Lipoxygena... 62 4e-09
gnl|LJGI|AV780099 similar to UniRef100_O24320 Cluster: Lipoxygen... 60 2e-08
gnl|LJGI|TC75730 similar to UniRef100_Q9M3Z5 Cluster: Lipoxygena... 58 6e-08
>gnl|LJGI|TC78762 similar to UniRef100_O04919 Cluster: Lipoxygenase; n=1; Vicia
faba|Rep: Lipoxygenase - Vicia faba (Broad bean),
partial (46%)
Length = 1204
Score = 147 bits (74), Expect = 8e-35
Identities = 134/154 (87%)
Strand = Plus / Plus
Query: 354 atttgcaagagagatcattgctggtgtaaatcctgctttaattcgttgtcttcatgagtt 413
||||||||||||||||||||||||||||||||||| |||| ||| ||||| |||||
Sbjct: 5 atttgcaagagagatcattgctggtgtaaatcctggtttagttcacatccttcaagagtt 64
Query: 414 tcctcccagaagtaagctagactatgaaatctatggggatcacacaagcacaataacaaa 473
|||||| | ||||||||||||| || | ||||||||||||| ||||||||||| || ||
Sbjct: 65 tcctccaaaaagtaagctagacagtggagtctatggggatcatacaagcacaattaccaa 124
Query: 474 agaatatatagagcgtaacttagatgggctcact 507
|||| | ||||||| |||||||||||||||||||
Sbjct: 125 agaacaaatagagcttaacttagatgggctcact 158
>gnl|LJGI|TC71649 similar to UniRef100_O04919 Cluster: Lipoxygenase; n=1; Vicia
faba|Rep: Lipoxygenase - Vicia faba (Broad bean),
partial (9%)
Length = 489
Score = 131 bits (66), Expect = 5e-30
Identities = 141/166 (84%)
Strand = Plus / Plus
Query: 343 actgatgtcgaatttgcaagagagatcattgctggtgtaaatcctgctttaattcgttgt 402
||||||| ||||||||||||||||||||||||||||||||||||| |||| ||
Sbjct: 127 actgatgaagaatttgcaagagagatcattgctggtgtaaatcctggtttagatcacatc 186
Query: 403 cttcatgagtttcctcccagaagtaagctagactatgaaatctatggggatcacacaagc 462
||||| ||||||||||| | ||||||||||||| |||| |||||||||||| |||||
Sbjct: 187 cttcaagagtttcctccaaaaagtaagctagacagtgaagtctatggggatcgtacaaga 246
Query: 463 acaataacaaaagaatatatagagcgtaacttagatgggctcactg 508
|||||||| |||||| | ||||||| ||||||||| |||||||||
Sbjct: 247 acaataaccaaagaacaaatagagcttaacttagaaaggctcactg 292
>gnl|LJGI|TC79119 similar to UniRef100_O04919 Cluster: Lipoxygenase; n=1; Vicia
faba|Rep: Lipoxygenase - Vicia faba (Broad bean),
partial (27%)
Length = 772
Score = 121 bits (61), Expect = 5e-27
Identities = 171/209 (81%), Gaps = 9/209 (4%)
Strand = Plus / Plus
Query: 307 cctaaagtgattcaagagagtgaatctgaatggatgactgatgtcgaatttgcaagagag 366
|||||||||||||||| || | |||| |||||||||||||| |||||||||||||||
Sbjct: 314 cctaaagtgattcaagtgaacaagtctgcatggatgactgatgaagaatttgcaagagag 373
Query: 367 atcattgctggtgtaaatcctgctttaattcgttgtcttcat---------gagtttcct 417
|||||||||||||||||||| || |||||||| ||||||||| ||||||||
Sbjct: 374 atcattgctggtgtaaatccagccttaattcgctgtcttcatcgaccagagcagtttcct 433
Query: 418 cccagaagtaagctagactatgaaatctatggggatcacacaagcacaataacaaaagaa 477
|| | |||||| || ||| || | |||||| ||||| || ||||||||||| ||||||
Sbjct: 434 ccaaaaagtaaccttgacagtggatcctatggtgatcatactagcacaataaccaaagaa 493
Query: 478 tatatagagcgtaacttagatgggctcac 506
| ||||||| ||||||||| ||||||||
Sbjct: 494 cacatagagcctaacttagacgggctcac 522
>gnl|LJGI|TC76657 similar to UniRef100_A7LCD6 Cluster: Lipoxygenase-10; n=1; Glycine
max|Rep: Lipoxygenase-10 - Glycine max (Soybean),
partial (24%)
Length = 654
Score = 77.8 bits (39), Expect = 6e-14
Identities = 75/87 (86%)
Strand = Plus / Plus
Query: 301 ccacctcctaaagtgattcaagagagtgaatctgaatggatgactgatgtcgaatttgca 360
||||| |||||||||||||||| || | | |||| |||||||||||||| ||||||||
Sbjct: 43 ccaccacctaaagtgattcaagtgaataagtctgcatggatgactgatgaagaatttgct 102
Query: 361 agagagatcattgctggtgtaaatcct 387
|| ||||| |||||||| |||||||||
Sbjct: 103 agggagatgattgctggagtaaatcct 129
>gnl|LJGI|TC81510 similar to UniRef100_O24470 Cluster: Lipoxygenase; n=1; Pisum
sativum|Rep: Lipoxygenase - Pisum sativum (Garden pea),
partial (38%)
Length = 1048
Score = 73.8 bits (37), Expect = 1e-12
Identities = 52/57 (91%)
Strand = Plus / Plus
Query: 331 tctgaatggatgactgatgtcgaatttgcaagagagatcattgctggtgtaaatcct 387
|||| ||||||||||||||| ||||||| ||||||||| ||||||||||| ||||||
Sbjct: 251 tctgcatggatgactgatgttgaatttggaagagagatgattgctggtgttaatcct 307
>gnl|LJGI|TC64177 similar to UniRef100_O04919 Cluster: Lipoxygenase; n=1; Vicia
faba|Rep: Lipoxygenase - Vicia faba (Broad bean),
partial (30%)
Length = 841
Score = 67.9 bits (34), Expect = 6e-11
Identities = 84/100 (84%), Gaps = 3/100 (3%)
Strand = Plus / Plus
Query: 46 ccttatcctcgtaggggaagaactggcagaaaaccaacaataaaagatcataatactgag 105
||||| ||||||||||||||||| ||||||||||||||| | ||||| | | ||||||
Sbjct: 739 ccttaccctcgtaggggaagaacaggcagaaaaccaacagccacagatcctcaaactgag 798
Query: 106 agcaaaagcagcacctattactatattccaagagatgaag 145
|||| |||||||| || ||| ||||||||||||||||
Sbjct: 799 agcagaagcagca---gtttctacattccaagagatgaag 835
>gnl|LJGI|TC57788 similar to UniRef100_O24470 Cluster: Lipoxygenase; n=1; Pisum
sativum|Rep: Lipoxygenase - Pisum sativum (Garden pea),
partial (96%)
Length = 2928
Score = 65.9 bits (33), Expect = 2e-10
Identities = 51/57 (89%)
Strand = Plus / Plus
Query: 331 tctgaatggatgactgatgtcgaatttgcaagagagatcattgctggtgtaaatcct 387
|||| |||||||||||||| ||||||| ||||||||| |||||||| |||||||||
Sbjct: 1169 tctgcatggatgactgatgaagaatttggaagagagatgattgctggagtaaatcct 1225
>gnl|LJGI|TC64500 similar to UniRef100_Q43817 Cluster: Lipoxygenase; n=1; Pisum
sativum|Rep: Lipoxygenase - Pisum sativum (Garden pea),
partial (51%)
Length = 1431
Score = 61.9 bits (31), Expect = 4e-09
Identities = 73/87 (83%)
Strand = Plus / Plus
Query: 301 ccacctcctaaagtgattcaagagagtgaatctgaatggatgactgatgtcgaatttgca 360
||||| |||||||||||||||| || | | |||| |||||||||||||| ||||| ||
Sbjct: 1149 ccaccacctaaagtgattcaagtgaataagtctgcatggatgactgatgaagaattggct 1208
Query: 361 agagagatcattgctggtgtaaatcct 387
|| ||||| || ||||| |||||||||
Sbjct: 1209 agggagatgatggctggagtaaatcct 1235
>gnl|LJGI|AV780099 similar to UniRef100_O24320 Cluster: Lipoxygenase; n=1; Phaseolus
vulgaris|Rep: Lipoxygenase - Phaseolus vulgaris (Kidney
bean) (French bean), partial (17%)
Length = 514
Score = 60.0 bits (30), Expect = 2e-08
Identities = 45/50 (90%)
Strand = Plus / Minus
Query: 338 ggatgactgatgtcgaatttgcaagagagatcattgctggtgtaaatcct 387
|||||||||||| ||||||| ||||||||| |||||||| |||||||||
Sbjct: 514 ggatgactgatgaagaatttggaagagagatgattgctggagtaaatcct 465
>gnl|LJGI|TC75730 similar to UniRef100_Q9M3Z5 Cluster: Lipoxygenase; n=1; Cicer
arietinum|Rep: Lipoxygenase - Cicer arietinum (Chickpea)
(Garbanzo), partial (93%)
Length = 1640
Score = 58.0 bits (29), Expect = 6e-08
Identities = 47/53 (88%)
Strand = Plus / Plus
Query: 331 tctgaatggatgactgatgtcgaatttgcaagagagatcattgctggtgtaaa 383
|||| |||||||||||||| || |||||||||||||| ||||| ||||||||
Sbjct: 7 tctgcatggatgactgatgatgagtttgcaagagagatgattgcgggtgtaaa 59