Miyakogusa Predicted Gene

Lj0g3v0340619.1

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj0g3v0340619.1 tr|G7KKS2|G7KKS2_MEDTR NBS-containing
resistance-like protein OS=Medicago truncatula
GN=MTR_6g078420,42.61,0,seg,NULL; Toll/Interleukin receptor TIR
domain,Toll/interleukin-1 receptor homology (TIR) domain; L
,CUFF.23309.1
         (4599 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|FS318368 similar to UniRef100_Q84ZV8 Cluster: R 3 prote...    64   8e-09
gnl|LJGI|TC75936 similar to UniRef100_A5JS46 Cluster: NBS-LRR re...    60   1e-07
gnl|LJGI|TC67901 weakly similar to UniRef100_A7QH65 Cluster: Chr...    56   2e-06
gnl|LJGI|BP064315 similar to UniRef100_Q2KPY3 Cluster: Resistanc...    54   8e-06

>gnl|LJGI|FS318368 similar to UniRef100_Q84ZV8 Cluster: R 3 protein; n=2; Glycine
           max|Rep: R 3 protein - Glycine max (Soybean), partial
           (15%)
          Length = 788

 Score = 63.9 bits (32), Expect = 8e-09
 Identities = 65/76 (85%)
 Strand = Plus / Plus

                                                                       
Query: 341 ttttctataatgtggatccatcagatgtgcggcatcagagagggagttatgaagaagcat 400
           |||||||||| |||||||| ||  |||||||||||||||  |||||||||| ||||||| 
Sbjct: 583 ttttctataacgtggatccttctcatgtgcggcatcagactgggagttatggagaagcac 642

                           
Query: 401 ttgttatgcttgaaga 416
           ||| || || ||||||
Sbjct: 643 ttgctaagcatgaaga 658


>gnl|LJGI|TC75936 similar to UniRef100_A5JS46 Cluster: NBS-LRR resistance-like protein
            RGC754; n=1; Helianthus tuberosus|Rep: NBS-LRR
            resistance-like protein RGC754 - Helianthus tuberosus
            (Jerusalem artichoke), partial (61%)
          Length = 749

 Score = 60.0 bits (30), Expect = 1e-07
 Identities = 93/114 (81%)
 Strand = Plus / Plus

                                                                        
Query: 901  aaaagagttctattggttattgataatgtggatgatgtggaccaactagaagcattagca 960
            ||||| ||||||||| || | ||| |||| |||||| | || ||| | |||||| | || 
Sbjct: 468  aaaagggttctattgattctggatgatgttgatgatatagaacaattggaagcacttgcc 527

                                                                  
Query: 961  ggaggatttgattggtttggtcctggaagcaggattatcataactacaagagat 1014
            ||||||| ||||||||||||| | || |||||||| || ||||| |||||||||
Sbjct: 528  ggaggatgtgattggtttggttccggtagcaggatcattataacaacaagagat 581


>gnl|LJGI|TC67901 weakly similar to UniRef100_A7QH65 Cluster: Chromosome chr18
           scaffold_96, whole genome shotgun sequence; n=1; Vitis
           vinifera|Rep: Chromosome chr18 scaffold_96, whole genome
           shotgun sequence - Vitis vinifera (Grape), partial (10%)
          Length = 853

 Score = 56.0 bits (28), Expect = 2e-06
 Identities = 37/40 (92%)
 Strand = Plus / Plus

                                                   
Query: 274 tggtgcctggacgaacttgtcaagattcttgagtgtaaga 313
           |||||| |||| |||||||||||||| |||||||||||||
Sbjct: 298 tggtgcttggatgaacttgtcaagatacttgagtgtaaga 337


>gnl|LJGI|BP064315 similar to UniRef100_Q2KPY3 Cluster: Resistance protein PLTR; n=1;
            Arachis hypogaea|Rep: Resistance protein PLTR - Arachis
            hypogaea (Peanut), partial (46%)
          Length = 350

 Score = 54.0 bits (27), Expect = 8e-06
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                           
Query: 969  tgattggtttggtcctggaagcaggattatcataactacaagagata 1015
            ||||||||||||| |||| |||||||| |||||||| ||||| ||||
Sbjct: 144  tgattggtttggttctggtagcaggatcatcataacaacaagggata 190