Miyakogusa Predicted Gene

Lj0g3v0340109.1

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj0g3v0340109.1 tr|G7JL85|G7JL85_MEDTR Abscisic acid
8'-hydroxylase OS=Medicago truncatula GN=MTR_4g086130 PE=3
SV=1,85.11,0,p450,Cytochrome P450; EP450I,Cytochrome P450, E-class,
group I; P450,Cytochrome P450; SUBFAMILY NOT ,CUFF.23269.1
         (1437 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC74875 similar to UniRef100_Q0H212 Cluster: Abscisic a...    76   7e-13
gnl|LJGI|TC77933 similar to UniRef100_Q0H212 Cluster: Abscisic a...    74   3e-12
gnl|LJGI|AW719401 similar to UniRef100_Q0H212 Cluster: Abscisic ...    54   2e-06

>gnl|LJGI|TC74875 similar to UniRef100_Q0H212 Cluster: Abscisic acid 8'-hydroxylase;
            n=1; Phaseolus vulgaris|Rep: Abscisic acid 8'-hydroxylase
            - Phaseolus vulgaris (Kidney bean) (French bean),
            complete
          Length = 1790

 Score = 75.8 bits (38), Expect = 7e-13
 Identities = 44/46 (95%)
 Strand = Plus / Plus

                                                          
Query: 1195 agatttgaggttgcaccaaaacccaatactttcatgccatttggca 1240
            |||||||||||||| |||||||||||||| ||||||||||||||||
Sbjct: 1222 agatttgaggttgctccaaaacccaatacattcatgccatttggca 1267


>gnl|LJGI|TC77933 similar to UniRef100_Q0H212 Cluster: Abscisic acid 8'-hydroxylase;
            n=1; Phaseolus vulgaris|Rep: Abscisic acid 8'-hydroxylase
            - Phaseolus vulgaris (Kidney bean) (French bean), partial
            (23%)
          Length = 551

 Score = 73.8 bits (37), Expect = 3e-12
 Identities = 46/49 (93%)
 Strand = Plus / Plus

                                                             
Query: 1192 tcaagatttgaggttgcaccaaaacccaatactttcatgccatttggca 1240
            ||||||||||||||||| ||||||||||| ||||| |||||||||||||
Sbjct: 112  tcaagatttgaggttgctccaaaacccaacacttttatgccatttggca 160


>gnl|LJGI|AW719401 similar to UniRef100_Q0H212 Cluster: Abscisic acid 8'-hydroxylase;
            n=1; Phaseolus vulgaris|Rep: Abscisic acid 8'-hydroxylase
            - Phaseolus vulgaris (Kidney bean) (French bean), partial
            (15%)
          Length = 641

 Score = 54.0 bits (27), Expect = 2e-06
 Identities = 36/39 (92%)
 Strand = Plus / Plus

                                                   
Query: 1202 aggttgcaccaaaacccaatactttcatgccatttggca 1240
            ||||||| |||||||||||||| ||||||| ||||||||
Sbjct: 225  aggttgctccaaaacccaatacattcatgctatttggca 263