Miyakogusa Predicted Gene
- Lj0g3v0339599.2
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj0g3v0339599.2 Non Chatacterized Hit- tr|I1K390|I1K390_SOYBN
Uncharacterized protein OS=Glycine max PE=4
SV=1,84.62,0,Pkinase,Protein kinase, catalytic domain; SUBFAMILY NOT
NAMED,NULL; FAMILY NOT NAMED,NULL; PROTEIN_K,CUFF.23228.2
(426 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|TC82172 homologue to UniRef100_Q76FZ8 Cluster: Brassino... 58 5e-08
>gnl|LJGI|TC82172 homologue to UniRef100_Q76FZ8 Cluster: Brassinosteroid receptor;
n=1; Pisum sativum|Rep: Brassinosteroid receptor - Pisum
sativum (Garden pea), partial (33%)
Length = 1668
Score = 58.0 bits (29), Expect = 5e-08
Identities = 35/37 (94%)
Strand = Plus / Plus
Query: 149 atatcattcccagggacatcaaatctagcaatgtatt 185
||||||||| ||||||||| |||||||||||||||||
Sbjct: 629 atatcattcacagggacatgaaatctagcaatgtatt 665