Miyakogusa Predicted Gene

Lj0g3v0339499.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj0g3v0339499.1 NODE_96886_length_1178_cov_12.750424.path1.1
         (1204 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC71633 similar to UniRef100_Q6V9R8 Cluster: Anti-Mulle...    74   2e-12

>gnl|LJGI|TC71633 similar to UniRef100_Q6V9R8 Cluster: Anti-Mullerian hormone; n=1;
            Macropus eugenii|Rep: Anti-Mullerian hormone - Macropus
            eugenii (Tammar wallaby), partial (3%)
          Length = 1286

 Score = 73.8 bits (37), Expect = 2e-12
 Identities = 67/77 (87%)
 Strand = Plus / Minus

                                                                        
Query: 260  agacgatggcggaagaagaaagatacgctacggtgggtgagcaaccatcagaagtagagg 319
            |||||| |||||||||||| ||  ||||||| |||||||||||||||||||| | || ||
Sbjct: 1169 agacgacggcggaagaagagaggcacgctacagtgggtgagcaaccatcagatgcagtgg 1110

                             
Query: 320  aagatttgacttctgag 336
            |||| || |||||||||
Sbjct: 1109 aagacttaacttctgag 1093