Miyakogusa Predicted Gene

Lj0g3v0338629.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj0g3v0338629.1 Non Chatacterized Hit- tr|K3WEW9|K3WEW9_PYTUL
Uncharacterized protein OS=Pythium ultimum
GN=PYU1_G00,35.86,2e-18,Actin depolymerizing proteins,NULL;
Gelsolin,Gelsolin domain; VILLIN 1-4,NULL; VILLIN,Gelsolin; no
d,CUFF.23158.1
         (465 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC81058 similar to UniRef100_O81645 Cluster: Villin-3; ...    64   8e-10
gnl|LJGI|BP065117 similar to UniRef100_O81645 Cluster: Villin-3;...    54   8e-07

>gnl|LJGI|TC81058 similar to UniRef100_O81645 Cluster: Villin-3; n=1; Arabidopsis
           thaliana|Rep: Villin-3 - Arabidopsis thaliana (Mouse-ear
           cress), partial (26%)
          Length = 1227

 Score = 63.9 bits (32), Expect = 8e-10
 Identities = 113/140 (80%)
 Strand = Plus / Plus

                                                                       
Query: 220 agtcaggatgaagcaggtgttgcagctatcaagacagttgagctggatgcagctcttgga 279
           |||||||||||||| ||   |||||| || || || ||||| || |||||| ||||||||
Sbjct: 522 agtcaggatgaagctggcactgcagccattaaaactgttgaacttgatgcatctcttgga 581

                                                                       
Query: 280 ggacgtgcagttcagtatcgtgaagtacaaggccatgaaactgaaaagttcctgtcttat 339
           |||||||| |||||| |  | ||| | ||||| |||||| |||| |||||  |||| || 
Sbjct: 582 ggacgtgctgttcagcacagggaaatccaagggcatgaatctgacaagtttttgtcatac 641

                               
Query: 340 ttcaagccctgtattatacc 359
           || ||||| |||||||||||
Sbjct: 642 tttaagccatgtattatacc 661


>gnl|LJGI|BP065117 similar to UniRef100_O81645 Cluster: Villin-3; n=1; Arabidopsis
           thaliana|Rep: Villin-3 - Arabidopsis thaliana (Mouse-ear
           cress), partial (15%)
          Length = 532

 Score = 54.0 bits (27), Expect = 8e-07
 Identities = 33/35 (94%)
 Strand = Plus / Plus

                                              
Query: 256 gttgagctggatgcagctcttggaggacgtgcagt 290
           ||||| || ||||||||||||||||||||||||||
Sbjct: 358 gttgaacttgatgcagctcttggaggacgtgcagt 392