Miyakogusa Predicted Gene

Lj0g3v0334929.1

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj0g3v0334929.1 Non Chatacterized Hit- tr|I1MF12|I1MF12_SOYBN
Uncharacterized protein OS=Glycine max GN=Gma.13812
PE,71.43,2e-19,N7-RELATED PROTEIN,NULL; F-BOX/LEUCINE RICH REPEAT
PROTEIN,NULL; no description,NULL,CUFF.22866.1
         (196 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC80874 weakly similar to UniRef100_O82023 Cluster: N7 ...   192   5e-49
gnl|LJGI|TC63939 similar to UniRef100_Q2HSK3 Cluster: Cyclin-lik...    74   3e-13
gnl|LJGI|TC70271 weakly similar to UniRef100_Q2HSK3 Cluster: Cyc...    58   2e-08

>gnl|LJGI|TC80874 weakly similar to UniRef100_O82023 Cluster: N7 protein; n=1;
           Medicago truncatula|Rep: N7 protein - Medicago
           truncatula (Barrel medic), partial (34%)
          Length = 1017

 Score =  192 bits (97), Expect = 5e-49
 Identities = 174/197 (88%), Gaps = 2/197 (1%)
 Strand = Plus / Plus

                                                                       
Query: 1   atgggcaaatgttgcccccatttgcaagtgctgaaatttaacatgcaggaaact-aaagg 59
           ||||||||||||||||| |||||| |||||||||||||||||||| |||  ||| |||||
Sbjct: 585 atgggcaaatgttgcccacatttgaaagtgctgaaatttaacatg-aggggactgaaagg 643

                                                                       
Query: 60  ctatgagtgtgatgatgaggcgtttgcgattgcgaaaaccatgcctcggctacgtcatat 119
           || ||| |||||||||||||| ||||| ||||| ||||||||||||| |||  ||||| |
Sbjct: 644 ctttgaatgtgatgatgaggcatttgctattgcaaaaaccatgcctcagctgtgtcatct 703

                                                                       
Query: 120 ccagcttctgggaaacagcctcactaatgaaggcttgcttgccattcttgatggatgccc 179
            |||||| |||||||||| ||||||||| | |||||| |||| ||||||||||| |||||
Sbjct: 704 tcagcttttgggaaacaggctcactaataacggcttgattgctattcttgatgggtgccc 763

                            
Query: 180 tcatcttgaatctcttg 196
           |||||||||||||||||
Sbjct: 764 tcatcttgaatctcttg 780


>gnl|LJGI|TC63939 similar to UniRef100_Q2HSK3 Cluster: Cyclin-like F-box; n=1;
           Medicago truncatula|Rep: Cyclin-like F-box - Medicago
           truncatula (Barrel medic), partial (37%)
          Length = 840

 Score = 73.8 bits (37), Expect = 3e-13
 Identities = 61/69 (88%)
 Strand = Plus / Plus

                                                                       
Query: 128 tgggaaacagcctcactaatgaaggcttgcttgccattcttgatggatgccctcatcttg 187
           |||||||||| |||| |||||| ||||||||||| ||||||||||| ||||||| ||| |
Sbjct: 373 tgggaaacagtctcagtaatgatggcttgcttgctattcttgatggttgccctcttctcg 432

                    
Query: 188 aatctcttg 196
           ||| |||||
Sbjct: 433 aatatcttg 441


>gnl|LJGI|TC70271 weakly similar to UniRef100_Q2HSK3 Cluster: Cyclin-like F-box; n=1;
           Medicago truncatula|Rep: Cyclin-like F-box - Medicago
           truncatula (Barrel medic), partial (28%)
          Length = 823

 Score = 58.0 bits (29), Expect = 2e-08
 Identities = 47/53 (88%)
 Strand = Plus / Plus

                                                                
Query: 144 taatgaaggcttgcttgccattcttgatggatgccctcatcttgaatctcttg 196
           |||||||||||||  ||||||||||||||| || |||| |||||||| |||||
Sbjct: 369 taatgaaggcttggatgccattcttgatggttgtcctcttcttgaatatcttg 421