Miyakogusa Predicted Gene

Lj0g3v0334769.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj0g3v0334769.1 tr|G7I7M2|G7I7M2_MEDTR CBL-interacting protein
kinase OS=Medicago truncatula GN=MTR_1g013700 PE=4
SV,41.1,0.017,NAF,NAF/FISL domain; seg,NULL,CUFF.22850.1
         (438 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|FS334602                                                      86   2e-16
gnl|LJGI|TC74196                                                       72   3e-12

>gnl|LJGI|FS334602 
          Length = 694

 Score = 85.7 bits (43), Expect = 2e-16
 Identities = 67/75 (89%)
 Strand = Plus / Minus

                                                                       
Query: 118 tcaccaattctagatcctgatgaatctaattccaatcccgattttgaattatcatctcaa 177
           ||||||||| |||||| |||||| || ||||||||||| |||||||||||||||||||||
Sbjct: 478 tcaccaattgtagatcttgatgactccaattccaatcctgattttgaattatcatctcaa 419

                          
Query: 178 aatcatacaacaaca 192
           || || ||| |||||
Sbjct: 418 aaccagacagcaaca 404



 Score = 67.9 bits (34), Expect = 5e-11
 Identities = 52/58 (89%)
 Strand = Plus / Minus

                                                                     
Query: 37  catcttgaattcccccaatttcctccgtccagcaaaggtttgagcaaaggtgttgggg 94
           |||||||||||||||||||||||||||||  |  |||||| ||||||||| |||||||
Sbjct: 540 catcttgaattcccccaatttcctccgtctggtgaaggttcgagcaaaggcgttgggg 483


>gnl|LJGI|TC74196 
          Length = 959

 Score = 71.9 bits (36), Expect = 3e-12
 Identities = 51/56 (91%)
 Strand = Plus / Plus

                                                                   
Query: 297 tgggttcgatctattgggattgttcaggagaagaggaagggagagggtttcagtgt 352
           ||||||||||||||||| ||| ||||||||||||||| | | ||||||||||||||
Sbjct: 889 tgggttcgatctattggaattattcaggagaagaggaggagggagggtttcagtgt 944