Miyakogusa Predicted Gene

Lj0g3v0334499.1

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj0g3v0334499.1 Non Chatacterized Hit- tr|K4B023|K4B023_SOLLC
Uncharacterized protein OS=Solanum lycopersicum
GN=Sol,61.24,0,PROTEIN_KINASE_ATP,Protein kinase, ATP binding site;
Protein kinase-like (PK-like),Protein kinase-li,CUFF.22830.1
         (553 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC59673 similar to UniRef100_Q8W107 Cluster: At2g46700/...   141   5e-33
gnl|LJGI|TC61721 similar to UniRef100_Q8RY07 Cluster: Serine/thr...    88   7e-17
gnl|LJGI|TC61580 homologue to UniRef100_Q2HT01 Cluster: Protein ...    66   2e-10

>gnl|LJGI|TC59673 similar to UniRef100_Q8W107 Cluster: At2g46700/T3A4.8; n=1;
           Arabidopsis thaliana|Rep: At2g46700/T3A4.8 - Arabidopsis
           thaliana (Mouse-ear cress), partial (21%)
          Length = 778

 Score =  141 bits (71), Expect = 5e-33
 Identities = 131/151 (86%)
 Strand = Plus / Plus

                                                                       
Query: 322 ctggataagagctttgggtatagcaagaatattggtgctaagtatgagcttgggaaggaa 381
           ||||| |||||||||||||| ||||||| | |||| |||||||||||||| |||||||| 
Sbjct: 628 ctggacaagagctttgggtacagcaagagttttggagctaagtatgagctggggaaggag 687

                                                                       
Query: 382 gtggggagagggcattttggtcatacttgctatgctaagggtaagaagggtgacctcaaa 441
           |||||  |||||||||| |||||||| |||| ||| | ||| ||||||||||| ||||||
Sbjct: 688 gtgggtcgagggcatttcggtcatacctgctctgcaaggggaaagaagggtgaactcaaa 747

                                          
Query: 442 gaccaacctgtagctgttaagattatttcca 472
           ||||||||| | |||||||| || |||||||
Sbjct: 748 gaccaacctcttgctgttaaaatcatttcca 778


>gnl|LJGI|TC61721 similar to UniRef100_Q8RY07 Cluster: Serine/threonine protein
           kinase pk23; n=1; Solanum lycopersicum|Rep:
           Serine/threonine protein kinase pk23 - Solanum
           lycopersicum (Tomato) (Lycopersicon esculentum), partial
           (79%)
          Length = 1730

 Score = 87.7 bits (44), Expect = 7e-17
 Identities = 101/120 (84%)
 Strand = Plus / Plus

                                                                       
Query: 321 gctggataagagctttgggtatagcaagaatattggtgctaagtatgagcttgggaagga 380
           |||||||||||||||||||||| | |||||| |||| || || | |||||| ||||||||
Sbjct: 17  gctggataagagctttgggtatgggaagaattttggggcgaaatttgagctggggaagga 76

                                                                       
Query: 381 agtggggagagggcattttggtcatacttgctatgctaagggtaagaagggtgacctcaa 440
           ||||||  | || ||||||||||| |||||||  || || || ||||||||||| |||||
Sbjct: 77  agtgggtcgtggacattttggtcacacttgctgggccaaagggaagaagggtgagctcaa 136


>gnl|LJGI|TC61580 homologue to UniRef100_Q2HT01 Cluster: Protein kinase;
           Calcium-binding EF-hand; n=1; Medicago truncatula|Rep:
           Protein kinase; Calcium-binding EF-hand - Medicago
           truncatula (Barrel medic), partial (16%)
          Length = 850

 Score = 65.9 bits (33), Expect = 2e-10
 Identities = 39/41 (95%)
 Strand = Plus / Plus

                                                    
Query: 199 cggccgtttccgccgccttcgccggcgaagcatatcagggc 239
           |||||||||||||| ||||||||||||||||||||| ||||
Sbjct: 696 cggccgtttccgcctccttcgccggcgaagcatatccgggc 736