Miyakogusa Predicted Gene
- Lj0g3v0332649.2
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj0g3v0332649.2 tr|Q6YSR3|Q6YSR3_BRANA Maturase-related protein
(Fragment) OS=Brassica napus GN=matR PE=4 SV=1,93.55,0.00000001,
,CUFF.22688.2
(272 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|TC76739 homologue to UniRef100_Q34597 Cluster: Maturase... 163 7e-40
gnl|LJGI|BW609164 homologue to UniRef100_Q34597 Cluster: Maturas... 155 2e-37
gnl|LJGI|TC75384 homologue to gb|M75722.1|ALSCP23SA Alnus incana... 58 3e-08
>gnl|LJGI|TC76739 homologue to UniRef100_Q34597 Cluster: Maturase-related protein;
n=1; Glycine max|Rep: Maturase-related protein - Glycine
max (Soybean), partial (26%)
Length = 551
Score = 163 bits (82), Expect = 7e-40
Identities = 85/86 (98%)
Strand = Plus / Plus
Query: 157 tctgcaggatcaacaacaatagctgcacggagtacggtagaattccttggtacggtcatt 216
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||
Sbjct: 128 tctgcaggatcaacaacaatagctgcacggagtacggtagaattcctcggtacggtcatt 187
Query: 217 cgggaagtccctccgaggacgactcc 242
||||||||||||||||||||||||||
Sbjct: 188 cgggaagtccctccgaggacgactcc 213
>gnl|LJGI|BW609164 homologue to UniRef100_Q34597 Cluster: Maturase-related protein;
n=1; Glycine max|Rep: Maturase-related protein - Glycine
max (Soybean), partial (21%)
Length = 450
Score = 155 bits (78), Expect = 2e-37
Identities = 84/86 (97%)
Strand = Plus / Plus
Query: 157 tctgcaggatcaacaacaatagctgcacggagtacggtagaattccttggtacggtcatt 216
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||
Sbjct: 246 tctgcaggatcaacaacaatagctgcacggagtacggtagaattccccggtacggtcatt 305
Query: 217 cgggaagtccctccgaggacgactcc 242
||||||||||||||||||||||||||
Sbjct: 306 cgggaagtccctccgaggacgactcc 331
>gnl|LJGI|TC75384 homologue to gb|M75722.1|ALSCP23SA Alnus incana chloroplast 23S
ribosomal RNA (23S rRNA) gene, partial (31%)
Length = 878
Score = 58.0 bits (29), Expect = 3e-08
Identities = 40/43 (93%), Gaps = 3/43 (6%)
Strand = Plus / Minus
Query: 120 gggctgtttccctctcga---tgaagcttatccctcatcgtct 159
|||||||||||||||||| ||||||||||||||||||||||
Sbjct: 511 gggctgtttccctctcgacgatgaagcttatccctcatcgtct 469