Miyakogusa Predicted Gene

Lj0g3v0332649.1

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj0g3v0332649.1 tr|Q6YSR3|Q6YSR3_BRANA Maturase-related protein
(Fragment) OS=Brassica napus GN=matR PE=4 SV=1,96.67,0.00000001,
,CUFF.22688.1
         (203 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC76739 homologue to UniRef100_Q34597 Cluster: Maturase...   163   5e-40
gnl|LJGI|BW609164 homologue to UniRef100_Q34597 Cluster: Maturas...   155   1e-37
gnl|LJGI|TC75384 homologue to gb|M75722.1|ALSCP23SA Alnus incana...    58   2e-08

>gnl|LJGI|TC76739 homologue to UniRef100_Q34597 Cluster: Maturase-related protein;
           n=1; Glycine max|Rep: Maturase-related protein - Glycine
           max (Soybean), partial (26%)
          Length = 551

 Score =  163 bits (82), Expect = 5e-40
 Identities = 85/86 (98%)
 Strand = Plus / Plus

                                                                       
Query: 112 tctgcaggatcaacaacaatagctgcacggagtacggtagaattccttggtacggtcatt 171
           ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||
Sbjct: 128 tctgcaggatcaacaacaatagctgcacggagtacggtagaattcctcggtacggtcatt 187

                                     
Query: 172 cgggaagtccctccgaggacgactcc 197
           ||||||||||||||||||||||||||
Sbjct: 188 cgggaagtccctccgaggacgactcc 213


>gnl|LJGI|BW609164 homologue to UniRef100_Q34597 Cluster: Maturase-related protein;
           n=1; Glycine max|Rep: Maturase-related protein - Glycine
           max (Soybean), partial (21%)
          Length = 450

 Score =  155 bits (78), Expect = 1e-37
 Identities = 84/86 (97%)
 Strand = Plus / Plus

                                                                       
Query: 112 tctgcaggatcaacaacaatagctgcacggagtacggtagaattccttggtacggtcatt 171
           ||||||||||||||||||||||||||||||||||||||||||||||  ||||||||||||
Sbjct: 246 tctgcaggatcaacaacaatagctgcacggagtacggtagaattccccggtacggtcatt 305

                                     
Query: 172 cgggaagtccctccgaggacgactcc 197
           ||||||||||||||||||||||||||
Sbjct: 306 cgggaagtccctccgaggacgactcc 331


>gnl|LJGI|TC75384 homologue to gb|M75722.1|ALSCP23SA Alnus incana chloroplast 23S
           ribosomal RNA (23S rRNA) gene, partial (31%)
          Length = 878

 Score = 58.0 bits (29), Expect = 2e-08
 Identities = 40/43 (93%), Gaps = 3/43 (6%)
 Strand = Plus / Minus

                                                      
Query: 75  gggctgtttccctctcga---tgaagcttatccctcatcgtct 114
           ||||||||||||||||||   ||||||||||||||||||||||
Sbjct: 511 gggctgtttccctctcgacgatgaagcttatccctcatcgtct 469