Miyakogusa Predicted Gene

Lj0g3v0331249.1

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj0g3v0331249.1 Non Chatacterized Hit- tr|B9T3K4|B9T3K4_RICCO
Glutathione s-transferase, putative OS=Ricinus
communi,73.68,0.00000006,GST_N_3,NULL; GST_NTER,Glutathione
S-transferase, N-terminal; no description,Thioredoxin-like
fold,CUFF.22585.1
         (127 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|DC598640 homologue to UniRef100_O49235 Cluster: 2,4-D i...    92   9e-19
gnl|LJGI|TC57411 similar to UniRef100_Q0PN10 Cluster: Glutathion...    92   9e-19
gnl|LJGI|GO023134 similar to UniRef100_O49235 Cluster: 2,4-D ind...    62   8e-10

>gnl|LJGI|DC598640 homologue to UniRef100_O49235 Cluster: 2,4-D inducible glutathione
           S-transferase; n=1; Glycine max|Rep: 2,4-D inducible
           glutathione S-transferase - Glycine max (Soybean),
           partial (48%)
          Length = 571

 Score = 91.7 bits (46), Expect = 9e-19
 Identities = 76/86 (88%)
 Strand = Plus / Plus

                                                                       
Query: 1   atggctgataaggtgattctgcttgatttctttgcatgtccatttgggatgagggtcaga 60
           ||||||||  ||||| |||| ||||||||||  ||| |||||||||| ||||| ||||||
Sbjct: 30  atggctgacgaggtggttcttcttgatttctgggcaagtccatttggaatgagagtcaga 89

                                     
Query: 61  attgcacttgctgaaaagggcatcaa 86
           |||||||||||||||||||| |||||
Sbjct: 90  attgcacttgctgaaaagggtatcaa 115


>gnl|LJGI|TC57411 similar to UniRef100_Q0PN10 Cluster: Glutathione S-transferase;
           n=1; Caragana korshinskii|Rep: Glutathione S-transferase
           - Caragana korshinskii, complete
          Length = 1318

 Score = 91.7 bits (46), Expect = 9e-19
 Identities = 76/86 (88%)
 Strand = Plus / Plus

                                                                       
Query: 1   atggctgataaggtgattctgcttgatttctttgcatgtccatttgggatgagggtcaga 60
           ||||||||  ||||| |||| ||||||||||  ||| |||||||||| ||||| ||||||
Sbjct: 54  atggctgacgaggtggttcttcttgatttctgggcaagtccatttggaatgagagtcaga 113

                                     
Query: 61  attgcacttgctgaaaagggcatcaa 86
           |||||||||||||||||||| |||||
Sbjct: 114 attgcacttgctgaaaagggtatcaa 139


>gnl|LJGI|GO023134 similar to UniRef100_O49235 Cluster: 2,4-D inducible glutathione
           S-transferase; n=1; Glycine max|Rep: 2,4-D inducible
           glutathione S-transferase - Glycine max (Soybean),
           partial (76%)
          Length = 606

 Score = 61.9 bits (31), Expect = 8e-10
 Identities = 64/75 (85%)
 Strand = Plus / Plus

                                                                       
Query: 1   atggctgataaggtgattctgcttgatttctttgcatgtccatttgggatgagggtcaga 60
           ||||||||  ||||| |||| ||||||||||  ||| ||||| |||  ||||| ||||||
Sbjct: 31  atggctgacgaggtggttcttcttgatttctgggcaagtccacttgaaatgagagtcaga 90

                          
Query: 61  attgcacttgctgaa 75
           |||||||||||||||
Sbjct: 91  attgcacttgctgaa 105