Miyakogusa Predicted Gene

Lj0g3v0329669.1

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj0g3v0329669.1 Non Chatacterized Hit- tr|J3N277|J3N277_ORYBR
Uncharacterized protein (Fragment) OS=Oryza
brachyanth,61.19,0.000000000000008,seg,NULL,CUFF.22449.1
         (355 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC59232 similar to UniRef100_A7QWW2 Cluster: Chromosome...   628   e-180
gnl|LJGI|AU088863 homologue to UniRef100_Q40199 Cluster: RAB11I;...    58   4e-08
gnl|LJGI|TC58220 RAB11I [Lotus japonicus]                              58   4e-08
gnl|LJGI|TC78859 homologue to UniRef100_A7PIM3 Cluster: Chromoso...    54   6e-07
gnl|LJGI|TC64728 homologue to UniRef100_Q08149 Cluster: GTP-bind...    54   6e-07
gnl|LJGI|TC57539 UniRef100_Q40191 Cluster: Ras-related protein R...    54   6e-07
gnl|LJGI|TC57268 homologue to UniRef100_Q08149 Cluster: GTP-bind...    50   9e-06

>gnl|LJGI|TC59232 similar to UniRef100_A7QWW2 Cluster: Chromosome chr13 scaffold_210,
           whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
           Chromosome chr13 scaffold_210, whole genome shotgun
           sequence - Vitis vinifera (Grape), partial (90%)
          Length = 1128

 Score =  628 bits (317), Expect = e-180
 Identities = 317/317 (100%)
 Strand = Plus / Minus

                                                                       
Query: 39  acctttcttggccagcggtgtcccatatttgagccttgacagttttgctatcgatgacga 98
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 353 acctttcttggccagcggtgtcccatatttgagccttgacagttttgctatcgatgacga 294

                                                                       
Query: 99  gggttttggtctgaaactcgacgccgatggtggctttggaatcgacgttgaattggttcc 158
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 293 gggttttggtctgaaactcgacgccgatggtggctttggaatcgacgttgaattggttcc 234

                                                                       
Query: 159 tcgaaaaccgagcgagaagctgggtcttgccgacggcggagtcaccgatcaacaccactt 218
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 233 tcgaaaaccgagcgagaagctgggtcttgccgacggcggagtcaccgatcaacaccactt 174

                                                                       
Query: 219 tgaaaacgtaatcgatcttctggttgaaatctccgtacaaattcgacatcactctctatc 278
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 173 tgaaaacgtaatcgatcttctggttgaaatctccgtacaaattcgacatcactctctatc 114

                                                                       
Query: 279 tatatcttgttgtgatcagaggcttaatccattcgtatatcagaaagaaaaaatcaaagg 338
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 113 tatatcttgttgtgatcagaggcttaatccattcgtatatcagaaagaaaaaatcaaagg 54

                            
Query: 339 tgtgtatgtagcgtagt 355
           |||||||||||||||||
Sbjct: 53  tgtgtatgtagcgtagt 37


>gnl|LJGI|AU088863 homologue to UniRef100_Q40199 Cluster: RAB11I; n=1; Lotus
          japonicus|Rep: RAB11I - Lotus japonicus, complete
          Length = 680

 Score = 58.0 bits (29), Expect = 4e-08
 Identities = 38/41 (92%)
 Strand = Plus / Minus

                                                   
Query: 41 ctttcttggccagcggtgtcccatatttgagccttgacagt 81
          |||||||| |||||||||||||| ||||| |||||||||||
Sbjct: 89 ctttcttgaccagcggtgtcccagatttgcgccttgacagt 49


>gnl|LJGI|TC58220 RAB11I [Lotus japonicus]
          Length = 1015

 Score = 58.0 bits (29), Expect = 4e-08
 Identities = 38/41 (92%)
 Strand = Plus / Minus

                                                    
Query: 41  ctttcttggccagcggtgtcccatatttgagccttgacagt 81
           |||||||| |||||||||||||| ||||| |||||||||||
Sbjct: 368 ctttcttgaccagcggtgtcccagatttgcgccttgacagt 328


>gnl|LJGI|TC78859 homologue to UniRef100_A7PIM3 Cluster: Chromosome chr13
           scaffold_17, whole genome shotgun sequence; n=1; Vitis
           vinifera|Rep: Chromosome chr13 scaffold_17, whole genome
           shotgun sequence - Vitis vinifera (Grape), complete
          Length = 1001

 Score = 54.0 bits (27), Expect = 6e-07
 Identities = 39/43 (90%)
 Strand = Plus / Minus

                                                      
Query: 39  acctttcttggccagcggtgtcccatatttgagccttgacagt 81
           |||| ||||| |||||||||||||||||||| ||||| |||||
Sbjct: 293 acctctcttgaccagcggtgtcccatatttgtgcctttacagt 251


>gnl|LJGI|TC64728 homologue to UniRef100_Q08149 Cluster: GTP-binding protein; n=1;
           Pisum sativum|Rep: GTP-binding protein - Pisum sativum
           (Garden pea), complete
          Length = 1184

 Score = 54.0 bits (27), Expect = 6e-07
 Identities = 33/35 (94%)
 Strand = Plus / Minus

                                              
Query: 41  ctttcttggccagcggtgtcccatatttgagcctt 75
           ||||||||||||||||||||||| ||||| |||||
Sbjct: 463 ctttcttggccagcggtgtcccaaatttgcgcctt 429


>gnl|LJGI|TC57539 UniRef100_Q40191 Cluster: Ras-related protein Rab11A; n=1; Lotus
           japonicus|Rep: Ras-related protein Rab11A - Lotus
           japonicus, complete
          Length = 985

 Score = 54.0 bits (27), Expect = 6e-07
 Identities = 51/59 (86%)
 Strand = Plus / Minus

                                                                      
Query: 41  ctttcttggccagcggtgtcccatatttgagccttgacagttttgctatcgatgacgag 99
           |||||||| ||||| |||||||| || ||||||||||| || |||  ||||||||||||
Sbjct: 295 ctttcttgaccagcagtgtcccagatctgagccttgacggtcttgtgatcgatgacgag 237


>gnl|LJGI|TC57268 homologue to UniRef100_Q08149 Cluster: GTP-binding protein; n=1;
           Pisum sativum|Rep: GTP-binding protein - Pisum sativum
           (Garden pea), complete
          Length = 1234

 Score = 50.1 bits (25), Expect = 9e-06
 Identities = 37/41 (90%)
 Strand = Plus / Minus

                                                    
Query: 39  acctttcttggccagcggtgtcccatatttgagccttgaca 79
           |||||||||| ||||| || ||||| |||||||||||||||
Sbjct: 439 acctttcttgaccagcagtatcccaaatttgagccttgaca 399