Miyakogusa Predicted Gene
- Lj0g3v0329239.1
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj0g3v0329239.1 tr|G7KGM9|G7KGM9_MEDTR Myb-like protein AA
OS=Medicago truncatula GN=MTR_5g041570 PE=4 SV=1,60.25,0,HTH_MYB,Myb
domain; seg,NULL; Homeodomain-like,Homeodomain-like;
Myb_DNA-bind_6,NULL; SANT SWI3, AD,gene.g25708.t1.1
(1041 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|TC63421 similar to UniRef100_A7NSM1 Cluster: Chromosome... 125 6e-28
>gnl|LJGI|TC63421 similar to UniRef100_A7NSM1 Cluster: Chromosome chr18 scaffold_1,
whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
Chromosome chr18 scaffold_1, whole genome shotgun
sequence - Vitis vinifera (Grape), partial (48%)
Length = 1244
Score = 125 bits (63), Expect = 6e-28
Identities = 188/227 (82%), Gaps = 2/227 (0%)
Strand = Plus / Plus
Query: 416 aaggaagatcagggaagagttgtaggctgagatggttcaaccagcttgatccaaggatta 475
||||||||||||| || ||||| || |||| ||||||||||||||||||||||| ||||
Sbjct: 204 aaggaagatcaggaaaaagttgcagattgaggtggttcaaccagcttgatccaagaatta 263
Query: 476 acaggagggctttcagtgaagaagaggaagaaaggctaat-gcaggcacatagaatttat 534
|||| ||| | |||| ||||| || ||||| |||||| | |||| | || ||| || ||
Sbjct: 264 acagaaggccattcacagaagaggaagaagagaggctacttgcag-ctcacagagttcat 322
Query: 535 ggcaacaaatgggccatgattgctaggctttttcctggaagaacagataatgctgtgaag 594
|| ||||| |||||| | || || ||||| || || || ||||| |||||||||||||||
Sbjct: 323 gggaacaagtgggccctcatagcaaggctcttcccaggtagaactgataatgctgtgaag 382
Query: 595 aatcactggcatgttatcatggctaggaaatatagggaacaatccaa 641
|||||||||||||| |||||||| ||||| | |||||||| |||||
Sbjct: 383 aatcactggcatgtcatcatggcaaggaagcagagggaacagtccaa 429