Miyakogusa Predicted Gene

Lj0g3v0327789.2
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj0g3v0327789.2 Non Chatacterized Hit- tr|I1MAK8|I1MAK8_SOYBN
Uncharacterized protein OS=Glycine max PE=3 SV=1,68.89,0,no
description,Ribonuclease II/R; RIBONUCLEASE_II,Ribonuclease II/R,
conserved site; seg,NULL; SUBFA,CUFF.22317.2
         (3261 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|DC594536 homologue to UniRef100_Q9XF04 Cluster: Protein...   180   4e-44

>gnl|LJGI|DC594536 homologue to UniRef100_Q9XF04 Cluster: Protein CLAVATA 3 precursor
           [Contains: MCLV3]; n=1; Arabidopsis thaliana|Rep:
           Protein CLAVATA 3 precursor [Contains: MCLV3] -
           Arabidopsis thaliana (Mouse-ear cress), partial (12%)
          Length = 430

 Score =  180 bits (91), Expect = 4e-44
 Identities = 91/91 (100%)
 Strand = Plus / Plus

                                                                       
Query: 1   atgaaagccgcagttgaaggatcatccatgggtaagaagcgccgatccaatcgtcgaacc 60
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 340 atgaaagccgcagttgaaggatcatccatgggtaagaagcgccgatccaatcgtcgaacc 399

                                          
Query: 61  aagcaaaacccatcttcattctcagcatctg 91
           |||||||||||||||||||||||||||||||
Sbjct: 400 aagcaaaacccatcttcattctcagcatctg 430