Miyakogusa Predicted Gene
- Lj0g3v0326869.1
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj0g3v0326869.1 Non Chatacterized Hit- tr|I3S192|I3S192_MEDTR
Uncharacterized protein OS=Medicago truncatula PE=2
SV,79.19,0,Branch,Glycosyl transferase, family 14; GLYCOSYLATION
ENZYME-LIKE PROTEIN,NULL; GLYCOSYLTRANSFERASE ,50820_g.1
(448 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|TC75712 similar to UniRef100_Q5BM97 Cluster: Secondary ... 54 8e-07
>gnl|LJGI|TC75712 similar to UniRef100_Q5BM97 Cluster: Secondary cell wall-related
glycosyltransferase family 14; n=1; Populus tremula x
Populus tremuloides|Rep: Secondary cell wall-related
glycosyltransferase family 14 - Populus tremula x
Populus tremuloides, partial (40%)
Length = 772
Score = 54.0 bits (27), Expect = 8e-07
Identities = 30/31 (96%)
Strand = Plus / Plus
Query: 314 tggtcacttacagaggaccaacaatggttgc 344
|||||||||||||||||||||||||| ||||
Sbjct: 506 tggtcacttacagaggaccaacaatgcttgc 536