Miyakogusa Predicted Gene

Lj0g3v0326609.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj0g3v0326609.1 tr|Q8W105|Q8W105_ARATH At1g50840/F8A12_8
OS=Arabidopsis thaliana GN=At1g50840 PE=2 SV=1,81.48,2e-19,no
description,NULL; DNA/RNA polymerases,NULL; DNA POLYMERASE
I,NULL,CUFF.22220.1
         (175 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC70834 similar to UniRef100_A7P230 Cluster: Chromosome...   153   4e-37

>gnl|LJGI|TC70834 similar to UniRef100_A7P230 Cluster: Chromosome chr19 scaffold_4,
           whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
           Chromosome chr19 scaffold_4, whole genome shotgun
           sequence - Vitis vinifera (Grape), partial (6%)
          Length = 582

 Score =  153 bits (77), Expect = 4e-37
 Identities = 140/161 (86%)
 Strand = Plus / Plus

                                                                       
Query: 10  caggttcatgatgaagtcatattggaaggaccaactgaatcagctgaggttgcaaagtct 69
           |||||||| |||||||||||||||||||| ||||| || || ||||||||||||||| | 
Sbjct: 19  caggttcacgatgaagtcatattggaagggccaacagagtcggctgaggttgcaaaggcc 78

                                                                       
Query: 70  atagttgttgagtgcatgtccaaacccttttatggcaagaatattcttaatgttgatctc 129
           |||||||| ||||||||||||||||||||| |||||||| | |||||||| || |  |||
Sbjct: 79  atagttgtcgagtgcatgtccaaaccctttaatggcaagcacattcttaaagtcgccctc 138

                                                    
Query: 130 tctgttgatgccaagtgtgctcaaaactggtactctggaaa 170
           ||||| |||||||||  ||||| |||||||||  |||||||
Sbjct: 139 tctgtggatgccaagattgctctaaactggtatgctggaaa 179