Miyakogusa Predicted Gene

Lj0g3v0324189.2
Show Alignment: 

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj0g3v0324189.2 tr|H8WVC7|H8WVC7_LOTJA E3 ubiquitin ligase-like
protein (Fragment) OS=Lotus japonicus GN=SINA5 PE=2 ,100,0,SEVEN IN
ABSENTIA HOMOLOG,Seven-in-absentia protein, sina; TRAF
domain-like,TRAF-like; ZF_SIAH,Zinc ,CUFF.22053.2
         (507 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|BP053570 similar to UniRef100_Q9XGC3 Cluster: SINA2p; n...   349   1e-95
gnl|LJGI|TC62546 similar to UniRef100_Q9XGC3 Cluster: SINA2p; n=...   337   4e-92
gnl|LJGI|TC69704 homologue to UniRef100_A8W464 Cluster: SINA5; n...    54   9e-07
gnl|LJGI|TC66464 homologue to UniRef100_A8W461 Cluster: SINA2; n...    54   9e-07

>gnl|LJGI|BP053570 similar to UniRef100_Q9XGC3 Cluster: SINA2p; n=1; Vitis
           vinifera|Rep: SINA2p - Vitis vinifera (Grape), partial
           (23%)
          Length = 448

 Score =  349 bits (176), Expect = 1e-95
 Identities = 200/208 (96%)
 Strand = Plus / Minus

                                                                       
Query: 300 gggtgaagacaatgaggcaagtaaatttaggttcactttggaagttggtgcaaatagccg 359
           |||||||||| ||||||| |||||||||||||||||||||||||||||||| ||||||||
Sbjct: 448 gggtgaagaccatgaggccagtaaatttaggttcactttggaagttggtgccaatagccg 389

                                                                       
Query: 360 taaacttatatggcaaggaattccaaggagcattcgcaatagtcatagaaaggttcgtga 419
           |||||||||||||| ||||||||| |||||||||||| ||||||||||||||||||||||
Sbjct: 388 taaacttatatggccaggaattcccaggagcattcgccatagtcatagaaaggttcgtga 329

                                                                       
Query: 420 ttgtcaagatggactcatcattccgaggcacttagctctttatttttctagtggggacaa 479
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 328 ttgtcaagatggactcatcattccgaggcacttagctctttatttttctagtggggacaa 269

                                       
Query: 480 gcaacaattgaagttcaagatcactggt 507
           || || ||||||||||||||||||||||
Sbjct: 268 gccaccattgaagttcaagatcactggt 241


>gnl|LJGI|TC62546 similar to UniRef100_Q9XGC3 Cluster: SINA2p; n=1; Vitis vinifera|Rep:
            SINA2p - Vitis vinifera (Grape), partial (89%)
          Length = 1323

 Score =  337 bits (170), Expect = 4e-92
 Identities = 398/474 (83%)
 Strand = Plus / Plus

                                                                        
Query: 3    gcttaagcatgagcaaaattgtcggtttcgtccgtacaagtgtccctatgctggatcaga 62
            ||||||||||||||| | |||| | |||||||| ||||| || || ||||||||||| ||
Sbjct: 650  gcttaagcatgagcagagttgtggatttcgtccatacaattgcccatatgctggatctga 709

                                                                        
Query: 63   gtgctctgtcatgggtgacattccaactctcttggtccatctcaagattgatcacaaggt 122
            ||||||||| ||||||||| |||| |||||| | | |||||| |||  ||||||||||||
Sbjct: 710  gtgctctgtgatgggtgaccttcctactctccttgcccatctaaaggatgatcacaaggt 769

                                                                        
Query: 123  tgacgtgcatgatggatgcacctttaaccatcgatatgtcaaatcaaatccacatgaagt 182
            |||| ||||||||||||||||||| || ||||||||||||||||||||||||||||||||
Sbjct: 770  tgacatgcatgatggatgcaccttcaatcatcgatatgtcaaatcaaatccacatgaagt 829

                                                                        
Query: 183  tgaaaacgccatatggatgctaactgtttttaattgttttgaaaggtatttctgcttgca 242
            ||| || |||| ||||||||||||| |||||||| ||||||  ||  | |||||||||||
Sbjct: 830  tgagaatgccacatggatgctaactatttttaatagttttgggagacacttctgcttgca 889

                                                                        
Query: 243  ctttgaggcatttttgctaggaaaagctccagtttatatagcctttttacgatttttggg 302
            ||||||||||||   | | || | |||||||||||| || |||||||| || ||||||||
Sbjct: 890  ctttgaggcattccagattggcacagctccagtttacatggcctttttgcggtttttggg 949

                                                                        
Query: 303  tgaagacaatgaggcaagtaaatttaggttcactttggaagttggtgcaaatagccgtaa 362
            ||| |||| ||| ||||  ||||| || | ||  ||||||||||| |||||| |||| ||
Sbjct: 950  tgaggacagtgaagcaaagaaattcagctacagcttggaagttggcgcaaatggccgcaa 1009

                                                                        
Query: 363  acttatatggcaaggaattccaaggagcattcgcaatagtcatagaaaggttcgtgattg 422
             |||| ||||||||||||||| |||||||||||  | |||||| | || ||||| ||| |
Sbjct: 1010 gcttacatggcaaggaattccgaggagcattcgtgacagtcatcggaaagttcgagatag 1069

                                                                  
Query: 423  tcaagatggactcatcattccgaggcacttagctctttatttttctagtgggga 476
            ||||||||| || || |||| |||| || | |  |||||||||||| |||||||
Sbjct: 1070 tcaagatggtcttataattcagaggaaccttggcctttatttttctggtgggga 1123


>gnl|LJGI|TC69704 homologue to UniRef100_A8W464 Cluster: SINA5; n=1; Medicago
           truncatula|Rep: SINA5 - Medicago truncatula (Barrel
           medic), partial (54%)
          Length = 678

 Score = 54.0 bits (27), Expect = 9e-07
 Identities = 68/79 (86%), Gaps = 2/79 (2%)
 Strand = Plus / Plus

                                                                       
Query: 135 tggatgcacctttaaccatcgatatgtcaaatcaaatccacat-gaagttgaaaacgcca 193
           ||||||||| ||||||||||| |||||||| || ||||| ||| ||||| ||||| || |
Sbjct: 68  tggatgcacttttaaccatcgttatgtcaagtccaatcc-catggaagtagaaaatgcta 126

                              
Query: 194 tatggatgctaactgtttt 212
            |||||||||||| |||||
Sbjct: 127 catggatgctaacggtttt 145


>gnl|LJGI|TC66464 homologue to UniRef100_A8W461 Cluster: SINA2; n=1; Medicago
           truncatula|Rep: SINA2 - Medicago truncatula (Barrel
           medic), partial (89%)
          Length = 1460

 Score = 54.0 bits (27), Expect = 9e-07
 Identities = 68/79 (86%), Gaps = 2/79 (2%)
 Strand = Plus / Plus

                                                                       
Query: 135 tggatgcacctttaaccatcgatatgtcaaatcaaatccacat-gaagttgaaaacgcca 193
           ||||||||| ||||||||||| |||||||| || ||||| ||| ||||| ||||| || |
Sbjct: 848 tggatgcacttttaaccatcgttatgtcaagtccaatcc-catggaagtagaaaatgcta 906

                              
Query: 194 tatggatgctaactgtttt 212
            |||||||||||| |||||
Sbjct: 907 catggatgctaacggtttt 925