Miyakogusa Predicted Gene

Lj0g3v0321539.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj0g3v0321539.1 Non Chatacterized Hit- tr|G0NPI0|G0NPI0_CAEBE
Putative uncharacterized protein OS=Caenorhabditis bre,30.77,2.5,
,gene.g25034.t1.1
         (444 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|DC595703 weakly similar to UniRef100_Q5NKL7 Cluster: G6...    66   2e-10

>gnl|LJGI|DC595703 weakly similar to UniRef100_Q5NKL7 Cluster: G6383; n=1;
           Cryptococcus neoformans var. grubii|Rep: G6383 -
           Cryptococcus neoformans var. grubii (Filobasidiella
           neoformans var.grubii), partial (3%)
          Length = 304

 Score = 65.9 bits (33), Expect = 2e-10
 Identities = 42/45 (93%)
 Strand = Plus / Minus

                                                        
Query: 80  catctgcaattagggttatccaccatgaatcggagaccatggcag 124
           ||||||||||||||||| ||| || ||||||||||||||||||||
Sbjct: 197 catctgcaattagggttgtccgccgtgaatcggagaccatggcag 153