Miyakogusa Predicted Gene

Lj0g3v0320689.2
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj0g3v0320689.2 Non Chatacterized Hit- tr|I3SL63|I3SL63_LOTJA
Uncharacterized protein OS=Lotus japonicus PE=2 SV=1,84.38,0.0000004,
,CUFF.21787.2
         (240 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC67912 homologue to UniRef100_Q9FEL8 Cluster: Auxin tr...   129   8e-30
gnl|LJGI|TC79664 similar to UniRef100_Q9FEL8 Cluster: Auxin tran...    52   2e-06

>gnl|LJGI|TC67912 homologue to UniRef100_Q9FEL8 Cluster: Auxin transporter-like
           protein 1; n=1; Medicago truncatula|Rep: Auxin
           transporter-like protein 1 - Medicago truncatula (Barrel
           medic), partial (50%)
          Length = 1008

 Score =  129 bits (65), Expect = 8e-30
 Identities = 86/93 (92%)
 Strand = Plus / Plus

                                                                       
Query: 109 aatgctgcagagaaattgctattcttcatccctaactggactttaatgtacatagtgaat 168
           |||||||||||||||||||  ||||||||||||||||||||||| |||||| | ||||||
Sbjct: 515 aatgctgcagagaaattgcccttcttcatccctaactggactttcatgtacgtggtgaat 574

                                            
Query: 169 gcatttgtggcgatttgggttttggtggtgggc 201
           |||||||||| |||||||||| |||||||||||
Sbjct: 575 gcatttgtggtgatttgggttctggtggtgggc 607


>gnl|LJGI|TC79664 similar to UniRef100_Q9FEL8 Cluster: Auxin transporter-like protein
           1; n=1; Medicago truncatula|Rep: Auxin transporter-like
           protein 1 - Medicago truncatula (Barrel medic), partial
           (18%)
          Length = 515

 Score = 52.0 bits (26), Expect = 2e-06
 Identities = 38/42 (90%)
 Strand = Plus / Plus

                                                     
Query: 109 aatgctgcagagaaattgctattcttcatccctaactggact 150
           |||||||||||||||||||  ||||||||||| | |||||||
Sbjct: 47  aatgctgcagagaaattgcccttcttcatcccaagctggact 88