Miyakogusa Predicted Gene

Lj0g3v0320639.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj0g3v0320639.1 tr|G7JF48|G7JF48_MEDTR Cysteine-rich
receptor-like protein kinase OS=Medicago truncatula
GN=MTR_4g08,59.29,0,B_lectin,Bulb-type lectin domain;
S_locus_glycop,S-locus glycoprotein; PAN_2,PAN-2 domain;
alpha-D-m,CUFF.21733.1
         (1152 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|GO024958                                                     111   1e-23
gnl|LJGI|TC78349 weakly similar to UniRef100_A7P182 Cluster: Chr...    64   2e-09
gnl|LJGI|BW594516 weakly similar to UniRef100_A7P197 Cluster: Ch...    54   2e-06

>gnl|LJGI|GO024958 
          Length = 692

 Score =  111 bits (56), Expect = 1e-23
 Identities = 101/116 (87%)
 Strand = Plus / Plus

                                                                        
Query: 1032 agggactgaccacgggagtgaaagaaggattataattcatatcactattgcttcaatttg 1091
            ||||||||| ||| || ||||| |||||||||||||| ||||||| ||||||||||||||
Sbjct: 33   agggactgaacacaggcgtgaacgaaggattataatttatatcaccattgcttcaatttg 92

                                                                    
Query: 1092 tggcttgctcgttccatgtctttattttgtctggagatttcgcaggaagattgttg 1147
            ||| |||||  | ||||||||||||||||| |||||| | | || |||||||||||
Sbjct: 93   tggattgcttctaccatgtctttattttgtttggagagtccacaagaagattgttg 148


>gnl|LJGI|TC78349 weakly similar to UniRef100_A7P182 Cluster: Chromosome chr19
           scaffold_4, whole genome shotgun sequence; n=1; Vitis
           vinifera|Rep: Chromosome chr19 scaffold_4, whole genome
           shotgun sequence - Vitis vinifera (Grape), partial (13%)
          Length = 1089

 Score = 63.9 bits (32), Expect = 2e-09
 Identities = 62/72 (86%)
 Strand = Plus / Plus

                                                                       
Query: 118 ggcaatctcgtggtgagaaatgagggagaaacaaaccaagaagagcatttgtggcagagt 177
           |||||||| ||| | || |||||||||| |||||||| ||||| | |||||||||| || 
Sbjct: 557 ggcaatcttgtgataaggaatgagggagcaacaaacccagaagcgtatttgtggcaaagc 616

                       
Query: 178 tttgactatcca 189
           ||||||||||||
Sbjct: 617 tttgactatcca 628


>gnl|LJGI|BW594516 weakly similar to UniRef100_A7P197 Cluster: Chromosome chr19
           scaffold_4, whole genome shotgun sequence; n=1; Vitis
           vinifera|Rep: Chromosome chr19 scaffold_4, whole genome
           shotgun sequence - Vitis vinifera (Grape), partial (17%)
          Length = 486

 Score = 54.0 bits (27), Expect = 2e-06
 Identities = 33/35 (94%)
 Strand = Plus / Plus

                                              
Query: 165 tttgtggcagagttttgactatccatccgacacat 199
           |||||||||||||||||| |||||||| |||||||
Sbjct: 283 tttgtggcagagttttgattatccatctgacacat 317