Miyakogusa Predicted Gene

Lj0g3v0320459.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj0g3v0320459.1 Non Chatacterized Hit- tr|I3SV88|I3SV88_MEDTR
Uncharacterized protein OS=Medicago truncatula PE=2
SV,58.49,0.000000001, ,CUFF.21717.1
         (163 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC69397 similar to UniRef100_A7QKA3 Cluster: Chromosome...    52   1e-06

>gnl|LJGI|TC69397 similar to UniRef100_A7QKA3 Cluster: Chromosome chr2 scaffold_112,
           whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
           Chromosome chr2 scaffold_112, whole genome shotgun
           sequence - Vitis vinifera (Grape), partial (97%)
          Length = 1475

 Score = 52.0 bits (26), Expect = 1e-06
 Identities = 65/78 (83%)
 Strand = Plus / Plus

                                                                       
Query: 46  tccatgaacttgctcctatacatggctcttatggcaacaatgattttgttttcttccact 105
           |||||||||||||| || ||||||||||  |||||  | ||||||||| || ||| ||||
Sbjct: 756 tccatgaacttgcttctctacatggctcccatggcggcgatgattttgcttcctttcact 815

                             
Query: 106 ttttacattgaagggaat 123
            | ||||| |||||||||
Sbjct: 816 ctctacatcgaagggaat 833