Miyakogusa Predicted Gene

Lj0g3v0315519.1
Show Alignment: 

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj0g3v0315519.1 tr|I1KLR0|I1KLR0_SOYBN Histone H3 OS=Glycine max
GN=Gma.58315 PE=3 SV=1,100,0,HISTONE H3,Histone H3;
HISTONE_H3_1,Histone H3; HISTONE_H3_2,Histone H3; HISTONEH3,Histone
H3; Histo,CUFF.21311.1
         (411 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC65076 UniRef100_P68428 Cluster: Histone H3.2; n=5; Ma...   537   e-152
gnl|LJGI|TC72069 UniRef100_P68428 Cluster: Histone H3.2; n=5; Ma...   450   e-126
gnl|LJGI|TC70534 UniRef100_P68428 Cluster: Histone H3.2; n=5; Ma...   276   1e-73
gnl|LJGI|TC65764 UniRef100_P68428 Cluster: Histone H3.2; n=5; Ma...   274   4e-73
gnl|LJGI|TC73033 UniRef100_P68428 Cluster: Histone H3.2; n=5; Ma...   270   6e-72
gnl|LJGI|TC77939 UniRef100_P68428 Cluster: Histone H3.2; n=5; Ma...   234   3e-61
gnl|LJGI|TC65133 UniRef100_P68428 Cluster: Histone H3.2; n=5; Ma...   224   3e-58
gnl|LJGI|TC60899 homologue to UniRef100_Q00YS0 Cluster: Histones...   149   2e-35
gnl|LJGI|TC71487 UniRef100_A5BX39 Cluster: Histone H3; n=4; core...   121   4e-27
gnl|LJGI|AV413508 UniRef100_Q8RUV0 Cluster: Histone H3-D; n=1; G...    98   5e-20
gnl|LJGI|TC60975 UniRef100_A5BX39 Cluster: Histone H3; n=4; core...    70   1e-11
gnl|LJGI|FS340942 UniRef100_P84243 Cluster: Histone H3.3; n=34; ...    68   5e-11

>gnl|LJGI|TC65076 UniRef100_P68428 Cluster: Histone H3.2; n=5; Magnoliophyta|Rep:
           Histone H3.2 - Triticum aestivum (Wheat), complete
          Length = 628

 Score =  537 bits (271), Expect = e-152
 Identities = 367/399 (91%)
 Strand = Plus / Plus

                                                                       
Query: 13  aagcaaactgctcgcaagtccaccggcggcaaggctccaaggaagcagctagctaccaaa 72
           |||||||| |||||||||||||||||||||||||| ||||||||||||||||| ||||| 
Sbjct: 61  aagcaaaccgctcgcaagtccaccggcggcaaggcaccaaggaagcagctagccaccaag 120

                                                                       
Query: 73  gccgctcggaagtcagccccggcaaccggtggcgtgaagaagcctcaccgtttcaggcca 132
           |||||||| ||||| || ||||| ||||| ||||||||||||||||||||||||||||||
Sbjct: 121 gccgctcgcaagtctgctccggcgaccggcggcgtgaagaagcctcaccgtttcaggcca 180

                                                                       
Query: 133 gggacggtagctctccgcgagatccgaaagtaccagaagagcactgagcttctgatccgc 192
           ||||| || |||||||| ||||||||||||||||||||||||||||||||||||||||| 
Sbjct: 181 gggactgttgctctccgtgagatccgaaagtaccagaagagcactgagcttctgatccgg 240

                                                                       
Query: 193 aagctcccgttccagcgcttggttcgtgagatcgcgcaggacttcaaaaccgacctccga 252
           ||||| |||||||||||  |||||||||||||||| ||||| ||||| ||||| ||||| 
Sbjct: 241 aagcttccgttccagcgactggttcgtgagatcgcacaggatttcaagaccgatctccgg 300

                                                                       
Query: 253 ttccagagctccgccgtctcagcgcttcaggaggccgccgaggcttaccttgttggactc 312
           |||||||||||||||||||| ||||| |||||||| ||||||||||||||||||||||||
Sbjct: 301 ttccagagctccgccgtctccgcgctccaggaggctgccgaggcttaccttgttggactc 360

                                                                       
Query: 313 ttcgaagataccaatctctgcgcaattcacgccaagcgcgtcaccatcatgccgaaggat 372
           || || |||||||||||||| ||||||||||||||||| || || |||||||||||||||
Sbjct: 361 tttgaggataccaatctctgtgcaattcacgccaagcgtgttactatcatgccgaaggat 420

                                                  
Query: 373 attcagctcgctaggcgcatcaggggcgagcgcgcttaa 411
           |||||||| ||||| ||||||||||||||||||||||||
Sbjct: 421 attcagcttgctagacgcatcaggggcgagcgcgcttaa 459


>gnl|LJGI|TC72069 UniRef100_P68428 Cluster: Histone H3.2; n=5; Magnoliophyta|Rep:
           Histone H3.2 - Triticum aestivum (Wheat), complete
          Length = 629

 Score =  450 bits (227), Expect = e-126
 Identities = 356/399 (89%)
 Strand = Plus / Plus

                                                                       
Query: 13  aagcaaactgctcgcaagtccaccggcggcaaggctccaaggaagcagctagctaccaaa 72
           |||||||| ||||||||||||||||||||||| |||||  | |||||||| || ||||| 
Sbjct: 82  aagcaaaccgctcgcaagtccaccggcggcaaagctccgcgtaagcagctggcaaccaag 141

                                                                       
Query: 73  gccgctcggaagtcagccccggcaaccggtggcgtgaagaagcctcaccgtttcaggcca 132
           |||||||| ||||| || ||||| ||||| ||||||||||||||||||||||||||||||
Sbjct: 142 gccgctcgcaagtctgctccggcgaccggcggcgtgaagaagcctcaccgtttcaggcca 201

                                                                       
Query: 133 gggacggtagctctccgcgagatccgaaagtaccagaagagcactgagcttctgatccgc 192
           || || || |||||||| ||||||||||||||||||||||||||||||||||||||||| 
Sbjct: 202 ggaacagtggctctccgtgagatccgaaagtaccagaagagcactgagcttctgatccgg 261

                                                                       
Query: 193 aagctcccgttccagcgcttggttcgtgagatcgcgcaggacttcaaaaccgacctccga 252
           ||||| |||||||||||  | || ||||||||||| ||||| ||||| ||||| ||||| 
Sbjct: 262 aagcttccgttccagcgactcgtccgtgagatcgcacaggatttcaagaccgatctccgg 321

                                                                       
Query: 253 ttccagagctccgccgtctcagcgcttcaggaggccgccgaggcttaccttgttggactc 312
           || ||||||||||||||||| ||||| || ||||| || ||||||||||| || || |||
Sbjct: 322 tttcagagctccgccgtctccgcgctgcaagaggcggcagaggcttacctcgtcgggctc 381

                                                                       
Query: 313 ttcgaagataccaatctctgcgcaattcacgccaagcgcgtcaccatcatgccgaaggat 372
           ||||| |||||||||||||| ||||||||||||||||| || ||||||||||||||||||
Sbjct: 382 ttcgaggataccaatctctgtgcaattcacgccaagcgtgtgaccatcatgccgaaggat 441

                                                  
Query: 373 attcagctcgctaggcgcatcaggggcgagcgcgcttaa 411
           |||||||| |||||||| |||||||||||||||||||||
Sbjct: 442 attcagcttgctaggcgtatcaggggcgagcgcgcttaa 480


>gnl|LJGI|TC70534 UniRef100_P68428 Cluster: Histone H3.2; n=5; Magnoliophyta|Rep:
           Histone H3.2 - Triticum aestivum (Wheat), complete
          Length = 734

 Score =  276 bits (139), Expect = 1e-73
 Identities = 316/375 (84%)
 Strand = Plus / Plus

                                                                       
Query: 28  aagtccaccggcggcaaggctccaaggaagcagctagctaccaaagccgctcggaagtca 87
           |||||||||||||||||||||||  |||||||||| || || || || ||  ||||||||
Sbjct: 103 aagtccaccggcggcaaggctccccggaagcagctggcgacaaaggcggcgaggaagtca 162

                                                                       
Query: 88  gccccggcaaccggtggcgtgaagaagcctcaccgtttcaggccagggacggtagctctc 147
           || ||||||||||| || ||||||||||| ||| | |||||||| || || || ||||| 
Sbjct: 163 gctccggcaaccggaggagtgaagaagccacacaggttcaggcctggaactgttgctctg 222

                                                                       
Query: 148 cgcgagatccgaaagtaccagaagagcactgagcttctgatccgcaagctcccgttccag 207
            | |||||| | ||||| |||||||| ||||||||||||||||| ||||| |||||||||
Sbjct: 223 agggagatcaggaagtatcagaagagtactgagcttctgatccggaagcttccgttccag 282

                                                                       
Query: 208 cgcttggttcgtgagatcgcgcaggacttcaaaaccgacctccgattccagagctccgcc 267
           || ||||||||||||||||| ||||| ||||| || || ||| | || ||||||   || 
Sbjct: 283 cgattggttcgtgagatcgctcaggatttcaagacggatctcaggtttcagagcagtgct 342

                                                                       
Query: 268 gtctcagcgcttcaggaggccgccgaggcttaccttgttggactcttcgaagataccaat 327
           ||||| ||||||||||| || || |||||||||||||||||| | || ||||||||||||
Sbjct: 343 gtctcggcgcttcaggaagcagcggaggcttaccttgttggattgtttgaagataccaat 402

                                                                       
Query: 328 ctctgcgcaattcacgccaagcgcgtcaccatcatgccgaaggatattcagctcgctagg 387
           ||||| || |||||||||||| | |||||||| ||||| ||||| ||||| |||||||||
Sbjct: 403 ctctgtgccattcacgccaagagagtcaccattatgcctaaggacattcaactcgctagg 462

                          
Query: 388 cgcatcaggggcgag 402
            | ||||| ||||||
Sbjct: 463 agaatcagaggcgag 477


>gnl|LJGI|TC65764 UniRef100_P68428 Cluster: Histone H3.2; n=5; Magnoliophyta|Rep:
           Histone H3.2 - Triticum aestivum (Wheat), complete
          Length = 627

 Score =  274 bits (138), Expect = 4e-73
 Identities = 327/390 (83%)
 Strand = Plus / Plus

                                                                       
Query: 13  aagcaaactgctcgcaagtccaccggcggcaaggctccaaggaagcagctagctaccaaa 72
           |||||||||||  | |||||||||||||||||||||||  |||||||||| || || || 
Sbjct: 84  aagcaaactgcaaggaagtccaccggcggcaaggctccccggaagcagctggcaactaag 143

                                                                       
Query: 73  gccgctcggaagtcagccccggcaaccggtggcgtgaagaagcctcaccgtttcaggcca 132
           || ||  |||||||||| ||||||||||| || ||||||||||| ||| | |||||||| 
Sbjct: 144 gcggcgaggaagtcagctccggcaaccggaggagtgaagaagccacacaggttcaggcct 203

                                                                       
Query: 133 gggacggtagctctccgcgagatccgaaagtaccagaagagcactgagcttctgatccgc 192
           || || || |||||  | |||||| | ||||| |||||||| ||||||||||||||||| 
Sbjct: 204 ggaactgttgctctgagggagatcaggaagtatcagaagagtactgagcttctgatccgg 263

                                                                       
Query: 193 aagctcccgttccagcgcttggttcgtgagatcgcgcaggacttcaaaaccgacctccga 252
           ||||| ||||||||||| ||||||||||||||||| ||||| ||||| || || ||| | 
Sbjct: 264 aagcttccgttccagcgattggttcgtgagatcgctcaggatttcaagacggatctcagg 323

                                                                       
Query: 253 ttccagagctccgccgtctcagcgcttcaggaggccgccgaggcttaccttgttggactc 312
           || ||||||   || ||||| ||||| ||||| || || |||||||||||||||||| | 
Sbjct: 324 tttcagagcagtgctgtctcggcgctccaggaagcagcggaggcttaccttgttggattg 383

                                                                       
Query: 313 ttcgaagataccaatctctgcgcaattcacgccaagcgcgtcaccatcatgccgaaggat 372
           || ||||||||||||||||| || |||||||||||| | |||||||| ||||| ||||| 
Sbjct: 384 tttgaagataccaatctctgtgccattcacgccaagagagtcaccattatgcctaaggac 443

                                         
Query: 373 attcagctcgctaggcgcatcaggggcgag 402
           ||||| ||||||||| | ||||| ||||||
Sbjct: 444 attcaactcgctaggagaatcagaggcgag 473


>gnl|LJGI|TC73033 UniRef100_P68428 Cluster: Histone H3.2; n=5; Magnoliophyta|Rep:
           Histone H3.2 - Triticum aestivum (Wheat), complete
          Length = 493

 Score =  270 bits (136), Expect = 6e-72
 Identities = 322/384 (83%)
 Strand = Plus / Plus

                                                                       
Query: 1   atggcacgcacgaagcaaactgctcgcaagtccaccggcggcaaggctccaaggaagcag 60
           |||||||| || |||||||| |||||||| ||||||||||| ||||| || |||||||||
Sbjct: 37  atggcacgtaccaagcaaaccgctcgcaaatccaccggcggaaaggcgccgaggaagcag 96

                                                                       
Query: 61  ctagctaccaaagccgctcggaagtcagccccggcaaccggtggcgtgaagaagcctcac 120
            | || ||||| ||||| || ||||| || ||||||||||| || |||||||||||||||
Sbjct: 97  ttggcgaccaaggccgcccgcaagtccgctccggcaaccggcggagtgaagaagcctcac 156

                                                                       
Query: 121 cgtttcaggccagggacggtagctctccgcgagatccgaaagtaccagaagagcactgag 180
           |||||||||||||| || || |||||  | |||||| | |||||||||||||||||||||
Sbjct: 157 cgtttcaggccaggaaccgtggctctgagggagatcaggaagtaccagaagagcactgag 216

                                                                       
Query: 181 cttctgatccgcaagctcccgttccagcgcttggttcgtgagatcgcgcaggacttcaaa 240
           ||||| ||||| ||||| ||||||||| |  ||||  | || ||||| ||||| ||||| 
Sbjct: 217 cttctcatccggaagcttccgttccagaggctggtcagagaaatcgctcaggatttcaag 276

                                                                       
Query: 241 accgacctccgattccagagctccgccgtctcagcgcttcaggaggccgccgaggcttac 300
           ||||| |||||||||||||||   || || || || || ||||| || || |||||||||
Sbjct: 277 accgatctccgattccagagcagtgctgtttctgctctacaggaagcggcagaggcttac 336

                                                                       
Query: 301 cttgttggactcttcgaagataccaatctctgcgcaattcacgccaagcgcgtcaccatc 360
           ||||||||||| ||||| |||||||||||||| || ||||| || ||| | || || |||
Sbjct: 337 cttgttggactgttcgaggataccaatctctgtgcgattcatgctaagagagttactatc 396

                                   
Query: 361 atgccgaaggatattcagctcgct 384
           ||||| ||||||||||| ||||||
Sbjct: 397 atgcctaaggatattcaactcgct 420


>gnl|LJGI|TC77939 UniRef100_P68428 Cluster: Histone H3.2; n=5; Magnoliophyta|Rep:
           Histone H3.2 - Triticum aestivum (Wheat), complete
          Length = 672

 Score =  234 bits (118), Expect = 3e-61
 Identities = 292/350 (83%)
 Strand = Plus / Plus

                                                                       
Query: 31  tccaccggcggcaaggctccaaggaagcagctagctaccaaagccgctcggaagtcagcc 90
           |||||||| |||||||| || |||||||||||||| ||||| ||||| || || || |||
Sbjct: 123 tccaccggaggcaaggcgccgaggaagcagctagcaaccaaggccgcccgcaaatctgcc 182

                                                                       
Query: 91  ccggcaaccggtggcgtgaagaagcctcaccgtttcaggccagggacggtagctctccgc 150
           || || ||||| |||||||||||||| ||||||||||| || || || || |||||  | 
Sbjct: 183 cctgccaccggcggcgtgaagaagccccaccgtttcagacctggaaccgtcgctctgagg 242

                                                                       
Query: 151 gagatccgaaagtaccagaagagcactgagcttctgatccgcaagctcccgttccagcgc 210
           |||||||| |||||||||||||||||||||||||| ||| | ||||| || |||||| | 
Sbjct: 243 gagatccgtaagtaccagaagagcactgagcttctcatcaggaagcttccattccagagg 302

                                                                       
Query: 211 ttggttcgtgagatcgcgcaggacttcaaaaccgacctccgattccagagctccgccgtc 270
            ||||  | |||||||| ||||| ||||| ||||| |||||||||||||||  |||||||
Sbjct: 303 ctggtcagagagatcgctcaggatttcaagaccgatctccgattccagagcagcgccgtc 362

                                                                       
Query: 271 tcagcgcttcaggaggccgccgaggcttaccttgttggactcttcgaagataccaatctc 330
           || || || || ||||| |||||||| ||||| ||||| || || || |||||||| |||
Sbjct: 363 tccgctctgcaagaggctgccgaggcgtacctggttgggctttttgaggataccaacctc 422

                                                             
Query: 331 tgcgcaattcacgccaagcgcgtcaccatcatgccgaaggatattcagct 380
           || || ||||| || ||| | || ||||||||||||||||||||||||||
Sbjct: 423 tgtgcgattcatgctaagagggtgaccatcatgccgaaggatattcagct 472


>gnl|LJGI|TC65133 UniRef100_P68428 Cluster: Histone H3.2; n=5; Magnoliophyta|Rep:
           Histone H3.2 - Triticum aestivum (Wheat), complete
          Length = 639

 Score =  224 bits (113), Expect = 3e-58
 Identities = 275/329 (83%)
 Strand = Plus / Plus

                                                                       
Query: 13  aagcaaactgctcgcaagtccaccggcggcaaggctccaaggaagcagctagctaccaaa 72
           |||||||| ||||||||||||||||| ||||| || ||| |||||||||| || ||||| 
Sbjct: 79  aagcaaaccgctcgcaagtccaccggaggcaaagccccacggaagcagctcgccaccaag 138

                                                                       
Query: 73  gccgctcggaagtcagccccggcaaccggtggcgtgaagaagcctcaccgtttcaggcca 132
           |||||  ||||||| || ||||| ||||| || ||||||||||||||||||||| | || 
Sbjct: 139 gccgccaggaagtccgctccggccaccggaggagtgaagaagcctcaccgtttccgccct 198

                                                                       
Query: 133 gggacggtagctctccgcgagatccgaaagtaccagaagagcactgagcttctgatccgc 192
           || || || || ||  | |||||| | |||||||||||||| || |||||||| ||| | 
Sbjct: 199 ggaaccgtcgccctgagggagatcaggaagtaccagaagagtaccgagcttctcatcagg 258

                                                                       
Query: 193 aagctcccgttccagcgcttggttcgtgagatcgcgcaggacttcaaaaccgacctccga 252
           ||||||||||||||| |  | ||  | |||||||||||||| ||||| ||||| ||| | 
Sbjct: 259 aagctcccgttccagaggctcgtgagggagatcgcgcaggatttcaagaccgatctcagg 318

                                                                       
Query: 253 ttccagagctccgccgtctcagcgcttcaggaggccgccgaggcttaccttgttggactc 312
           |||||||||  ||||||||| ||||||||||| ||||| |||||||||||||| || |||
Sbjct: 319 ttccagagcagcgccgtctctgcgcttcaggaagccgctgaggcttaccttgtgggtctc 378

                                        
Query: 313 ttcgaagataccaatctctgcgcaattca 341
           || || |||||||||||||| ||||||||
Sbjct: 379 tttgaggataccaatctctgtgcaattca 407


>gnl|LJGI|TC60899 homologue to UniRef100_Q00YS0 Cluster: Histones H3 and H4; n=2;
           Ostreococcus|Rep: Histones H3 and H4 - Ostreococcus
           tauri, partial (86%)
          Length = 849

 Score =  149 bits (75), Expect = 2e-35
 Identities = 318/399 (79%)
 Strand = Plus / Plus

                                                                       
Query: 13  aagcaaactgctcgcaagtccaccggcggcaaggctccaaggaagcagctagctaccaaa 72
           |||||||||||||| ||||| || || || |||||||||||||||||||| || || || 
Sbjct: 77  aagcaaactgctcgtaagtcaactggtggaaaggctccaaggaagcagctggcaactaag 136

                                                                       
Query: 73  gccgctcggaagtcagccccggcaaccggtggcgtgaagaagcctcaccgtttcaggcca 132
           || || || ||||| || ||  | || ||||| |||||||||||||| |||| | | || 
Sbjct: 137 gctgcacgtaagtctgcaccaactactggtggtgtgaagaagcctcatcgttaccgtcct 196

                                                                       
Query: 133 gggacggtagctctccgcgagatccgaaagtaccagaagagcactgagcttctgatccgc 192
           || || || ||||| || |||||  | |||||||||||||| |||||||| |||||| | 
Sbjct: 197 ggaactgttgctcttcgtgagattaggaagtaccagaagagtactgagctgctgatcagg 256

                                                                       
Query: 193 aagctcccgttccagcgcttggttcgtgagatcgcgcaggacttcaaaaccgacctccga 252
           |||||||| |||||| |  ||||||||||||| || ||||| ||||| || || ||||| 
Sbjct: 257 aagctccccttccagaggctggttcgtgagattgctcaggatttcaagactgatctccgt 316

                                                                       
Query: 253 ttccagagctccgccgtctcagcgcttcaggaggccgccgaggcttaccttgttggactc 312
           ||||||||    || ||    ||  | || ||||| || ||||| |||||||||||||| 
Sbjct: 317 ttccagagtcatgctgtgcttgcattgcaagaggctgctgaggcataccttgttggactg 376

                                                                       
Query: 313 ttcgaagataccaatctctgcgcaattcacgccaagcgcgtcaccatcatgccgaaggat 372
           || || || ||||| || || || |||||||||||||| ||||| |||||||| ||||||
Sbjct: 377 tttgaggacaccaacctgtgtgccattcacgccaagcgtgtcactatcatgcccaaggat 436

                                                  
Query: 373 attcagctcgctaggcgcatcaggggcgagcgcgcttaa 411
           || ||||| |||||| | ||| | || ||||||||||||
Sbjct: 437 atccagctggctaggaggatccgtggagagcgcgcttaa 475


>gnl|LJGI|TC71487 UniRef100_A5BX39 Cluster: Histone H3; n=4; core eudicotyledons|Rep:
           Histone H3 - Vitis vinifera (Grape), complete
          Length = 726

 Score =  121 bits (61), Expect = 4e-27
 Identities = 202/249 (81%)
 Strand = Plus / Plus

                                                                       
Query: 13  aagcaaactgctcgcaagtccaccggcggcaaggctccaaggaagcagctagctaccaaa 72
           |||||||| |||||||| |||||||| || |||||||| |||||||| || || ||||| 
Sbjct: 84  aagcaaaccgctcgcaaatccaccggaggaaaggctcccaggaagcaactcgccaccaag 143

                                                                       
Query: 73  gccgctcggaagtcagccccggcaaccggtggcgtgaagaagcctcaccgtttcaggcca 132
           || ||  |||| || || ||  | |||||||| || ||||||||||| || |   | || 
Sbjct: 144 gctgcgaggaaatctgctcctactaccggtggagtcaagaagcctcatcgctatcgtcct 203

                                                                       
Query: 133 gggacggtagctctccgcgagatccgaaagtaccagaagagcactgagcttctgatccgc 192
           || || || ||||| || |||||||| |||||||||||||| ||||||||||||||||||
Sbjct: 204 ggaactgttgctcttcgtgagatccgtaagtaccagaagagtactgagcttctgatccgc 263

                                                                       
Query: 193 aagctcccgttccagcgcttggttcgtgagatcgcgcaggacttcaaaaccgacctccga 252
           ||||| || ||||||||  | |||||||| ||||| ||||| ||||| || ||  | |||
Sbjct: 264 aagcttccattccagcgtcttgttcgtgaaatcgcacaggatttcaagactgatttgcga 323

                    
Query: 253 ttccagagc 261
           |||||||||
Sbjct: 324 ttccagagc 332


>gnl|LJGI|AV413508 UniRef100_Q8RUV0 Cluster: Histone H3-D; n=1; Glycine
           tomentella|Rep: Histone H3-D - Glycine tomentella
           (Woolly glycine), partial (88%)
          Length = 250

 Score = 97.6 bits (49), Expect = 5e-20
 Identities = 79/89 (88%)
 Strand = Plus / Plus

                                                                       
Query: 151 gagatccgaaagtaccagaagagcactgagcttctgatccgcaagctcccgttccagcgc 210
           |||||||| |||||||||||||| ||||||||||||||||||||||| || |||||||| 
Sbjct: 153 gagatccgtaagtaccagaagagtactgagcttctgatccgcaagcttccattccagcgt 212

                                        
Query: 211 ttggttcgtgagatcgcgcaggacttcaa 239
            | |||||||| ||||| ||||| |||||
Sbjct: 213 cttgttcgtgaaatcgcacaggatttcaa 241


>gnl|LJGI|TC60975 UniRef100_A5BX39 Cluster: Histone H3; n=4; core eudicotyledons|Rep:
           Histone H3 - Vitis vinifera (Grape), complete
          Length = 715

 Score = 69.9 bits (35), Expect = 1e-11
 Identities = 53/59 (89%)
 Strand = Plus / Plus

                                                                      
Query: 13  aagcaaactgctcgcaagtccaccggcggcaaggctccaaggaagcagctagctaccaa 71
           |||||||| |||||||| |||||||| || |||||||||||||||||||| || |||||
Sbjct: 90  aagcaaaccgctcgcaaatccaccggtggaaaggctccaaggaagcagctcgcaaccaa 148


>gnl|LJGI|FS340942 UniRef100_P84243 Cluster: Histone H3.3; n=34; Bilateria|Rep:
           Histone H3.3 - Homo sapiens (Human), complete
          Length = 779

 Score = 67.9 bits (34), Expect = 5e-11
 Identities = 73/86 (84%)
 Strand = Plus / Plus

                                                                       
Query: 175 actgagcttctgatccgcaagctcccgttccagcgcttggttcgtgagatcgcgcaggac 234
           |||||| | |||||||||||||| || ||||||||  | |||||||| || || ||||||
Sbjct: 238 actgagttgctgatccgcaagctgcctttccagcgacttgttcgtgaaattgctcaggac 297

                                     
Query: 235 ttcaaaaccgacctccgattccagag 260
           |||||||| ||||| || ||||||||
Sbjct: 298 ttcaaaactgaccttcgtttccagag 323