Miyakogusa Predicted Gene
- Lj0g3v0315519.1
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj0g3v0315519.1 tr|I1KLR0|I1KLR0_SOYBN Histone H3 OS=Glycine max
GN=Gma.58315 PE=3 SV=1,100,0,HISTONE H3,Histone H3;
HISTONE_H3_1,Histone H3; HISTONE_H3_2,Histone H3; HISTONEH3,Histone
H3; Histo,CUFF.21311.1
(411 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|TC65076 UniRef100_P68428 Cluster: Histone H3.2; n=5; Ma... 537 e-152
gnl|LJGI|TC72069 UniRef100_P68428 Cluster: Histone H3.2; n=5; Ma... 450 e-126
gnl|LJGI|TC70534 UniRef100_P68428 Cluster: Histone H3.2; n=5; Ma... 276 1e-73
gnl|LJGI|TC65764 UniRef100_P68428 Cluster: Histone H3.2; n=5; Ma... 274 4e-73
gnl|LJGI|TC73033 UniRef100_P68428 Cluster: Histone H3.2; n=5; Ma... 270 6e-72
gnl|LJGI|TC77939 UniRef100_P68428 Cluster: Histone H3.2; n=5; Ma... 234 3e-61
gnl|LJGI|TC65133 UniRef100_P68428 Cluster: Histone H3.2; n=5; Ma... 224 3e-58
gnl|LJGI|TC60899 homologue to UniRef100_Q00YS0 Cluster: Histones... 149 2e-35
gnl|LJGI|TC71487 UniRef100_A5BX39 Cluster: Histone H3; n=4; core... 121 4e-27
gnl|LJGI|AV413508 UniRef100_Q8RUV0 Cluster: Histone H3-D; n=1; G... 98 5e-20
gnl|LJGI|TC60975 UniRef100_A5BX39 Cluster: Histone H3; n=4; core... 70 1e-11
gnl|LJGI|FS340942 UniRef100_P84243 Cluster: Histone H3.3; n=34; ... 68 5e-11
>gnl|LJGI|TC65076 UniRef100_P68428 Cluster: Histone H3.2; n=5; Magnoliophyta|Rep:
Histone H3.2 - Triticum aestivum (Wheat), complete
Length = 628
Score = 537 bits (271), Expect = e-152
Identities = 367/399 (91%)
Strand = Plus / Plus
Query: 13 aagcaaactgctcgcaagtccaccggcggcaaggctccaaggaagcagctagctaccaaa 72
|||||||| |||||||||||||||||||||||||| ||||||||||||||||| |||||
Sbjct: 61 aagcaaaccgctcgcaagtccaccggcggcaaggcaccaaggaagcagctagccaccaag 120
Query: 73 gccgctcggaagtcagccccggcaaccggtggcgtgaagaagcctcaccgtttcaggcca 132
|||||||| ||||| || ||||| ||||| ||||||||||||||||||||||||||||||
Sbjct: 121 gccgctcgcaagtctgctccggcgaccggcggcgtgaagaagcctcaccgtttcaggcca 180
Query: 133 gggacggtagctctccgcgagatccgaaagtaccagaagagcactgagcttctgatccgc 192
||||| || |||||||| |||||||||||||||||||||||||||||||||||||||||
Sbjct: 181 gggactgttgctctccgtgagatccgaaagtaccagaagagcactgagcttctgatccgg 240
Query: 193 aagctcccgttccagcgcttggttcgtgagatcgcgcaggacttcaaaaccgacctccga 252
||||| ||||||||||| |||||||||||||||| ||||| ||||| ||||| |||||
Sbjct: 241 aagcttccgttccagcgactggttcgtgagatcgcacaggatttcaagaccgatctccgg 300
Query: 253 ttccagagctccgccgtctcagcgcttcaggaggccgccgaggcttaccttgttggactc 312
|||||||||||||||||||| ||||| |||||||| ||||||||||||||||||||||||
Sbjct: 301 ttccagagctccgccgtctccgcgctccaggaggctgccgaggcttaccttgttggactc 360
Query: 313 ttcgaagataccaatctctgcgcaattcacgccaagcgcgtcaccatcatgccgaaggat 372
|| || |||||||||||||| ||||||||||||||||| || || |||||||||||||||
Sbjct: 361 tttgaggataccaatctctgtgcaattcacgccaagcgtgttactatcatgccgaaggat 420
Query: 373 attcagctcgctaggcgcatcaggggcgagcgcgcttaa 411
|||||||| ||||| ||||||||||||||||||||||||
Sbjct: 421 attcagcttgctagacgcatcaggggcgagcgcgcttaa 459
>gnl|LJGI|TC72069 UniRef100_P68428 Cluster: Histone H3.2; n=5; Magnoliophyta|Rep:
Histone H3.2 - Triticum aestivum (Wheat), complete
Length = 629
Score = 450 bits (227), Expect = e-126
Identities = 356/399 (89%)
Strand = Plus / Plus
Query: 13 aagcaaactgctcgcaagtccaccggcggcaaggctccaaggaagcagctagctaccaaa 72
|||||||| ||||||||||||||||||||||| ||||| | |||||||| || |||||
Sbjct: 82 aagcaaaccgctcgcaagtccaccggcggcaaagctccgcgtaagcagctggcaaccaag 141
Query: 73 gccgctcggaagtcagccccggcaaccggtggcgtgaagaagcctcaccgtttcaggcca 132
|||||||| ||||| || ||||| ||||| ||||||||||||||||||||||||||||||
Sbjct: 142 gccgctcgcaagtctgctccggcgaccggcggcgtgaagaagcctcaccgtttcaggcca 201
Query: 133 gggacggtagctctccgcgagatccgaaagtaccagaagagcactgagcttctgatccgc 192
|| || || |||||||| |||||||||||||||||||||||||||||||||||||||||
Sbjct: 202 ggaacagtggctctccgtgagatccgaaagtaccagaagagcactgagcttctgatccgg 261
Query: 193 aagctcccgttccagcgcttggttcgtgagatcgcgcaggacttcaaaaccgacctccga 252
||||| ||||||||||| | || ||||||||||| ||||| ||||| ||||| |||||
Sbjct: 262 aagcttccgttccagcgactcgtccgtgagatcgcacaggatttcaagaccgatctccgg 321
Query: 253 ttccagagctccgccgtctcagcgcttcaggaggccgccgaggcttaccttgttggactc 312
|| ||||||||||||||||| ||||| || ||||| || ||||||||||| || || |||
Sbjct: 322 tttcagagctccgccgtctccgcgctgcaagaggcggcagaggcttacctcgtcgggctc 381
Query: 313 ttcgaagataccaatctctgcgcaattcacgccaagcgcgtcaccatcatgccgaaggat 372
||||| |||||||||||||| ||||||||||||||||| || ||||||||||||||||||
Sbjct: 382 ttcgaggataccaatctctgtgcaattcacgccaagcgtgtgaccatcatgccgaaggat 441
Query: 373 attcagctcgctaggcgcatcaggggcgagcgcgcttaa 411
|||||||| |||||||| |||||||||||||||||||||
Sbjct: 442 attcagcttgctaggcgtatcaggggcgagcgcgcttaa 480
>gnl|LJGI|TC70534 UniRef100_P68428 Cluster: Histone H3.2; n=5; Magnoliophyta|Rep:
Histone H3.2 - Triticum aestivum (Wheat), complete
Length = 734
Score = 276 bits (139), Expect = 1e-73
Identities = 316/375 (84%)
Strand = Plus / Plus
Query: 28 aagtccaccggcggcaaggctccaaggaagcagctagctaccaaagccgctcggaagtca 87
||||||||||||||||||||||| |||||||||| || || || || || ||||||||
Sbjct: 103 aagtccaccggcggcaaggctccccggaagcagctggcgacaaaggcggcgaggaagtca 162
Query: 88 gccccggcaaccggtggcgtgaagaagcctcaccgtttcaggccagggacggtagctctc 147
|| ||||||||||| || ||||||||||| ||| | |||||||| || || || |||||
Sbjct: 163 gctccggcaaccggaggagtgaagaagccacacaggttcaggcctggaactgttgctctg 222
Query: 148 cgcgagatccgaaagtaccagaagagcactgagcttctgatccgcaagctcccgttccag 207
| |||||| | ||||| |||||||| ||||||||||||||||| ||||| |||||||||
Sbjct: 223 agggagatcaggaagtatcagaagagtactgagcttctgatccggaagcttccgttccag 282
Query: 208 cgcttggttcgtgagatcgcgcaggacttcaaaaccgacctccgattccagagctccgcc 267
|| ||||||||||||||||| ||||| ||||| || || ||| | || |||||| ||
Sbjct: 283 cgattggttcgtgagatcgctcaggatttcaagacggatctcaggtttcagagcagtgct 342
Query: 268 gtctcagcgcttcaggaggccgccgaggcttaccttgttggactcttcgaagataccaat 327
||||| ||||||||||| || || |||||||||||||||||| | || ||||||||||||
Sbjct: 343 gtctcggcgcttcaggaagcagcggaggcttaccttgttggattgtttgaagataccaat 402
Query: 328 ctctgcgcaattcacgccaagcgcgtcaccatcatgccgaaggatattcagctcgctagg 387
||||| || |||||||||||| | |||||||| ||||| ||||| ||||| |||||||||
Sbjct: 403 ctctgtgccattcacgccaagagagtcaccattatgcctaaggacattcaactcgctagg 462
Query: 388 cgcatcaggggcgag 402
| ||||| ||||||
Sbjct: 463 agaatcagaggcgag 477
>gnl|LJGI|TC65764 UniRef100_P68428 Cluster: Histone H3.2; n=5; Magnoliophyta|Rep:
Histone H3.2 - Triticum aestivum (Wheat), complete
Length = 627
Score = 274 bits (138), Expect = 4e-73
Identities = 327/390 (83%)
Strand = Plus / Plus
Query: 13 aagcaaactgctcgcaagtccaccggcggcaaggctccaaggaagcagctagctaccaaa 72
||||||||||| | ||||||||||||||||||||||| |||||||||| || || ||
Sbjct: 84 aagcaaactgcaaggaagtccaccggcggcaaggctccccggaagcagctggcaactaag 143
Query: 73 gccgctcggaagtcagccccggcaaccggtggcgtgaagaagcctcaccgtttcaggcca 132
|| || |||||||||| ||||||||||| || ||||||||||| ||| | ||||||||
Sbjct: 144 gcggcgaggaagtcagctccggcaaccggaggagtgaagaagccacacaggttcaggcct 203
Query: 133 gggacggtagctctccgcgagatccgaaagtaccagaagagcactgagcttctgatccgc 192
|| || || ||||| | |||||| | ||||| |||||||| |||||||||||||||||
Sbjct: 204 ggaactgttgctctgagggagatcaggaagtatcagaagagtactgagcttctgatccgg 263
Query: 193 aagctcccgttccagcgcttggttcgtgagatcgcgcaggacttcaaaaccgacctccga 252
||||| ||||||||||| ||||||||||||||||| ||||| ||||| || || ||| |
Sbjct: 264 aagcttccgttccagcgattggttcgtgagatcgctcaggatttcaagacggatctcagg 323
Query: 253 ttccagagctccgccgtctcagcgcttcaggaggccgccgaggcttaccttgttggactc 312
|| |||||| || ||||| ||||| ||||| || || |||||||||||||||||| |
Sbjct: 324 tttcagagcagtgctgtctcggcgctccaggaagcagcggaggcttaccttgttggattg 383
Query: 313 ttcgaagataccaatctctgcgcaattcacgccaagcgcgtcaccatcatgccgaaggat 372
|| ||||||||||||||||| || |||||||||||| | |||||||| ||||| |||||
Sbjct: 384 tttgaagataccaatctctgtgccattcacgccaagagagtcaccattatgcctaaggac 443
Query: 373 attcagctcgctaggcgcatcaggggcgag 402
||||| ||||||||| | ||||| ||||||
Sbjct: 444 attcaactcgctaggagaatcagaggcgag 473
>gnl|LJGI|TC73033 UniRef100_P68428 Cluster: Histone H3.2; n=5; Magnoliophyta|Rep:
Histone H3.2 - Triticum aestivum (Wheat), complete
Length = 493
Score = 270 bits (136), Expect = 6e-72
Identities = 322/384 (83%)
Strand = Plus / Plus
Query: 1 atggcacgcacgaagcaaactgctcgcaagtccaccggcggcaaggctccaaggaagcag 60
|||||||| || |||||||| |||||||| ||||||||||| ||||| || |||||||||
Sbjct: 37 atggcacgtaccaagcaaaccgctcgcaaatccaccggcggaaaggcgccgaggaagcag 96
Query: 61 ctagctaccaaagccgctcggaagtcagccccggcaaccggtggcgtgaagaagcctcac 120
| || ||||| ||||| || ||||| || ||||||||||| || |||||||||||||||
Sbjct: 97 ttggcgaccaaggccgcccgcaagtccgctccggcaaccggcggagtgaagaagcctcac 156
Query: 121 cgtttcaggccagggacggtagctctccgcgagatccgaaagtaccagaagagcactgag 180
|||||||||||||| || || ||||| | |||||| | |||||||||||||||||||||
Sbjct: 157 cgtttcaggccaggaaccgtggctctgagggagatcaggaagtaccagaagagcactgag 216
Query: 181 cttctgatccgcaagctcccgttccagcgcttggttcgtgagatcgcgcaggacttcaaa 240
||||| ||||| ||||| ||||||||| | |||| | || ||||| ||||| |||||
Sbjct: 217 cttctcatccggaagcttccgttccagaggctggtcagagaaatcgctcaggatttcaag 276
Query: 241 accgacctccgattccagagctccgccgtctcagcgcttcaggaggccgccgaggcttac 300
||||| ||||||||||||||| || || || || || ||||| || || |||||||||
Sbjct: 277 accgatctccgattccagagcagtgctgtttctgctctacaggaagcggcagaggcttac 336
Query: 301 cttgttggactcttcgaagataccaatctctgcgcaattcacgccaagcgcgtcaccatc 360
||||||||||| ||||| |||||||||||||| || ||||| || ||| | || || |||
Sbjct: 337 cttgttggactgttcgaggataccaatctctgtgcgattcatgctaagagagttactatc 396
Query: 361 atgccgaaggatattcagctcgct 384
||||| ||||||||||| ||||||
Sbjct: 397 atgcctaaggatattcaactcgct 420
>gnl|LJGI|TC77939 UniRef100_P68428 Cluster: Histone H3.2; n=5; Magnoliophyta|Rep:
Histone H3.2 - Triticum aestivum (Wheat), complete
Length = 672
Score = 234 bits (118), Expect = 3e-61
Identities = 292/350 (83%)
Strand = Plus / Plus
Query: 31 tccaccggcggcaaggctccaaggaagcagctagctaccaaagccgctcggaagtcagcc 90
|||||||| |||||||| || |||||||||||||| ||||| ||||| || || || |||
Sbjct: 123 tccaccggaggcaaggcgccgaggaagcagctagcaaccaaggccgcccgcaaatctgcc 182
Query: 91 ccggcaaccggtggcgtgaagaagcctcaccgtttcaggccagggacggtagctctccgc 150
|| || ||||| |||||||||||||| ||||||||||| || || || || ||||| |
Sbjct: 183 cctgccaccggcggcgtgaagaagccccaccgtttcagacctggaaccgtcgctctgagg 242
Query: 151 gagatccgaaagtaccagaagagcactgagcttctgatccgcaagctcccgttccagcgc 210
|||||||| |||||||||||||||||||||||||| ||| | ||||| || |||||| |
Sbjct: 243 gagatccgtaagtaccagaagagcactgagcttctcatcaggaagcttccattccagagg 302
Query: 211 ttggttcgtgagatcgcgcaggacttcaaaaccgacctccgattccagagctccgccgtc 270
|||| | |||||||| ||||| ||||| ||||| ||||||||||||||| |||||||
Sbjct: 303 ctggtcagagagatcgctcaggatttcaagaccgatctccgattccagagcagcgccgtc 362
Query: 271 tcagcgcttcaggaggccgccgaggcttaccttgttggactcttcgaagataccaatctc 330
|| || || || ||||| |||||||| ||||| ||||| || || || |||||||| |||
Sbjct: 363 tccgctctgcaagaggctgccgaggcgtacctggttgggctttttgaggataccaacctc 422
Query: 331 tgcgcaattcacgccaagcgcgtcaccatcatgccgaaggatattcagct 380
|| || ||||| || ||| | || ||||||||||||||||||||||||||
Sbjct: 423 tgtgcgattcatgctaagagggtgaccatcatgccgaaggatattcagct 472
>gnl|LJGI|TC65133 UniRef100_P68428 Cluster: Histone H3.2; n=5; Magnoliophyta|Rep:
Histone H3.2 - Triticum aestivum (Wheat), complete
Length = 639
Score = 224 bits (113), Expect = 3e-58
Identities = 275/329 (83%)
Strand = Plus / Plus
Query: 13 aagcaaactgctcgcaagtccaccggcggcaaggctccaaggaagcagctagctaccaaa 72
|||||||| ||||||||||||||||| ||||| || ||| |||||||||| || |||||
Sbjct: 79 aagcaaaccgctcgcaagtccaccggaggcaaagccccacggaagcagctcgccaccaag 138
Query: 73 gccgctcggaagtcagccccggcaaccggtggcgtgaagaagcctcaccgtttcaggcca 132
||||| ||||||| || ||||| ||||| || ||||||||||||||||||||| | ||
Sbjct: 139 gccgccaggaagtccgctccggccaccggaggagtgaagaagcctcaccgtttccgccct 198
Query: 133 gggacggtagctctccgcgagatccgaaagtaccagaagagcactgagcttctgatccgc 192
|| || || || || | |||||| | |||||||||||||| || |||||||| ||| |
Sbjct: 199 ggaaccgtcgccctgagggagatcaggaagtaccagaagagtaccgagcttctcatcagg 258
Query: 193 aagctcccgttccagcgcttggttcgtgagatcgcgcaggacttcaaaaccgacctccga 252
||||||||||||||| | | || | |||||||||||||| ||||| ||||| ||| |
Sbjct: 259 aagctcccgttccagaggctcgtgagggagatcgcgcaggatttcaagaccgatctcagg 318
Query: 253 ttccagagctccgccgtctcagcgcttcaggaggccgccgaggcttaccttgttggactc 312
||||||||| ||||||||| ||||||||||| ||||| |||||||||||||| || |||
Sbjct: 319 ttccagagcagcgccgtctctgcgcttcaggaagccgctgaggcttaccttgtgggtctc 378
Query: 313 ttcgaagataccaatctctgcgcaattca 341
|| || |||||||||||||| ||||||||
Sbjct: 379 tttgaggataccaatctctgtgcaattca 407
>gnl|LJGI|TC60899 homologue to UniRef100_Q00YS0 Cluster: Histones H3 and H4; n=2;
Ostreococcus|Rep: Histones H3 and H4 - Ostreococcus
tauri, partial (86%)
Length = 849
Score = 149 bits (75), Expect = 2e-35
Identities = 318/399 (79%)
Strand = Plus / Plus
Query: 13 aagcaaactgctcgcaagtccaccggcggcaaggctccaaggaagcagctagctaccaaa 72
|||||||||||||| ||||| || || || |||||||||||||||||||| || || ||
Sbjct: 77 aagcaaactgctcgtaagtcaactggtggaaaggctccaaggaagcagctggcaactaag 136
Query: 73 gccgctcggaagtcagccccggcaaccggtggcgtgaagaagcctcaccgtttcaggcca 132
|| || || ||||| || || | || ||||| |||||||||||||| |||| | | ||
Sbjct: 137 gctgcacgtaagtctgcaccaactactggtggtgtgaagaagcctcatcgttaccgtcct 196
Query: 133 gggacggtagctctccgcgagatccgaaagtaccagaagagcactgagcttctgatccgc 192
|| || || ||||| || ||||| | |||||||||||||| |||||||| |||||| |
Sbjct: 197 ggaactgttgctcttcgtgagattaggaagtaccagaagagtactgagctgctgatcagg 256
Query: 193 aagctcccgttccagcgcttggttcgtgagatcgcgcaggacttcaaaaccgacctccga 252
|||||||| |||||| | ||||||||||||| || ||||| ||||| || || |||||
Sbjct: 257 aagctccccttccagaggctggttcgtgagattgctcaggatttcaagactgatctccgt 316
Query: 253 ttccagagctccgccgtctcagcgcttcaggaggccgccgaggcttaccttgttggactc 312
|||||||| || || || | || ||||| || ||||| ||||||||||||||
Sbjct: 317 ttccagagtcatgctgtgcttgcattgcaagaggctgctgaggcataccttgttggactg 376
Query: 313 ttcgaagataccaatctctgcgcaattcacgccaagcgcgtcaccatcatgccgaaggat 372
|| || || ||||| || || || |||||||||||||| ||||| |||||||| ||||||
Sbjct: 377 tttgaggacaccaacctgtgtgccattcacgccaagcgtgtcactatcatgcccaaggat 436
Query: 373 attcagctcgctaggcgcatcaggggcgagcgcgcttaa 411
|| ||||| |||||| | ||| | || ||||||||||||
Sbjct: 437 atccagctggctaggaggatccgtggagagcgcgcttaa 475
>gnl|LJGI|TC71487 UniRef100_A5BX39 Cluster: Histone H3; n=4; core eudicotyledons|Rep:
Histone H3 - Vitis vinifera (Grape), complete
Length = 726
Score = 121 bits (61), Expect = 4e-27
Identities = 202/249 (81%)
Strand = Plus / Plus
Query: 13 aagcaaactgctcgcaagtccaccggcggcaaggctccaaggaagcagctagctaccaaa 72
|||||||| |||||||| |||||||| || |||||||| |||||||| || || |||||
Sbjct: 84 aagcaaaccgctcgcaaatccaccggaggaaaggctcccaggaagcaactcgccaccaag 143
Query: 73 gccgctcggaagtcagccccggcaaccggtggcgtgaagaagcctcaccgtttcaggcca 132
|| || |||| || || || | |||||||| || ||||||||||| || | | ||
Sbjct: 144 gctgcgaggaaatctgctcctactaccggtggagtcaagaagcctcatcgctatcgtcct 203
Query: 133 gggacggtagctctccgcgagatccgaaagtaccagaagagcactgagcttctgatccgc 192
|| || || ||||| || |||||||| |||||||||||||| ||||||||||||||||||
Sbjct: 204 ggaactgttgctcttcgtgagatccgtaagtaccagaagagtactgagcttctgatccgc 263
Query: 193 aagctcccgttccagcgcttggttcgtgagatcgcgcaggacttcaaaaccgacctccga 252
||||| || |||||||| | |||||||| ||||| ||||| ||||| || || | |||
Sbjct: 264 aagcttccattccagcgtcttgttcgtgaaatcgcacaggatttcaagactgatttgcga 323
Query: 253 ttccagagc 261
|||||||||
Sbjct: 324 ttccagagc 332
>gnl|LJGI|AV413508 UniRef100_Q8RUV0 Cluster: Histone H3-D; n=1; Glycine
tomentella|Rep: Histone H3-D - Glycine tomentella
(Woolly glycine), partial (88%)
Length = 250
Score = 97.6 bits (49), Expect = 5e-20
Identities = 79/89 (88%)
Strand = Plus / Plus
Query: 151 gagatccgaaagtaccagaagagcactgagcttctgatccgcaagctcccgttccagcgc 210
|||||||| |||||||||||||| ||||||||||||||||||||||| || ||||||||
Sbjct: 153 gagatccgtaagtaccagaagagtactgagcttctgatccgcaagcttccattccagcgt 212
Query: 211 ttggttcgtgagatcgcgcaggacttcaa 239
| |||||||| ||||| ||||| |||||
Sbjct: 213 cttgttcgtgaaatcgcacaggatttcaa 241
>gnl|LJGI|TC60975 UniRef100_A5BX39 Cluster: Histone H3; n=4; core eudicotyledons|Rep:
Histone H3 - Vitis vinifera (Grape), complete
Length = 715
Score = 69.9 bits (35), Expect = 1e-11
Identities = 53/59 (89%)
Strand = Plus / Plus
Query: 13 aagcaaactgctcgcaagtccaccggcggcaaggctccaaggaagcagctagctaccaa 71
|||||||| |||||||| |||||||| || |||||||||||||||||||| || |||||
Sbjct: 90 aagcaaaccgctcgcaaatccaccggtggaaaggctccaaggaagcagctcgcaaccaa 148
>gnl|LJGI|FS340942 UniRef100_P84243 Cluster: Histone H3.3; n=34; Bilateria|Rep:
Histone H3.3 - Homo sapiens (Human), complete
Length = 779
Score = 67.9 bits (34), Expect = 5e-11
Identities = 73/86 (84%)
Strand = Plus / Plus
Query: 175 actgagcttctgatccgcaagctcccgttccagcgcttggttcgtgagatcgcgcaggac 234
|||||| | |||||||||||||| || |||||||| | |||||||| || || ||||||
Sbjct: 238 actgagttgctgatccgcaagctgcctttccagcgacttgttcgtgaaattgctcaggac 297
Query: 235 ttcaaaaccgacctccgattccagag 260
|||||||| ||||| || ||||||||
Sbjct: 298 ttcaaaactgaccttcgtttccagag 323