Miyakogusa Predicted Gene
- Lj0g3v0315129.1
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj0g3v0315129.1 tr|D2VRC6|D2VRC6_NAEGR GATA zinc
finger-containing protein OS=Naegleria gruberi GN=NAEGRDRAFT_71538
,47.73,0.1,seg,NULL,CUFF.21285.1
(339 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|TC65527 homologue to UniRef100_A7RMP1 Cluster: Predicte... 664 0.0
gnl|LJGI|GO036373 UniRef100_Q1M182 Cluster: HMGA2f; n=1; Homo sa... 98 4e-20
>gnl|LJGI|TC65527 homologue to UniRef100_A7RMP1 Cluster: Predicted protein; n=1;
Nematostella vectensis|Rep: Predicted protein -
Nematostella vectensis (Starlet sea anemone), partial
(7%)
Length = 652
Score = 664 bits (335), Expect = 0.0
Identities = 338/339 (99%)
Strand = Plus / Plus
Query: 1 atgtgtgacactcgtaatccagaggggaggcagcaccaattcacacctgtcggtgtcgag 60
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 34 atgtgtgacactcgtaatccagaggggaggcagcaccaattcacacctgtcggtgtcgag 93
Query: 61 tctgcttcccctacgactcccagcgtggtgactaccccacaaacgaattcttcacagaaa 120
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 94 tctgcttcccctacgactcccagcgtggtgactaccccacaaacgaattcttcacagaaa 153
Query: 121 agcgctcaacgtgggcgccccaaaggtagcaagaacaagccaaaacccttgccaattgat 180
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 154 agcgctcaacgtgggcgccccaaaggtagcaagaacaagccaaaacccttgccaattgat 213
Query: 181 ttgttggaaccagttatgggggaggacagagtgacgacgcgagcccaacgaacttggttt 240
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 214 ttgttggaaccagttatgggggaggacagagtgacgacgcgagcccaacgaacttggttg 273
Query: 241 attggcaagcaattgggtttgaagcctagagggtcagaagctctgatgcttagaggacta 300
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 274 attggcaagcaattgggtttgaagcctagagggtcagaagctctgatgcttagaggacta 333
Query: 301 gaggctcaaatacgacaaaatcacccccatctccgttga 339
|||||||||||||||||||||||||||||||||||||||
Sbjct: 334 gaggctcaaatacgacaaaatcacccccatctccgttga 372
>gnl|LJGI|GO036373 UniRef100_Q1M182 Cluster: HMGA2f; n=1; Homo sapiens|Rep: HMGA2f -
Homo sapiens (Human), partial (14%)
Length = 487
Score = 97.6 bits (49), Expect = 4e-20
Identities = 79/89 (88%)
Strand = Plus / Plus
Query: 251 aattgggtttgaagcctagagggtcagaagctctgatgcttagaggactagaggctcaaa 310
|||||||||||||||| ||||||||||||||| |||||||||||||| ||||||| || |
Sbjct: 331 aattgggtttgaagccaagagggtcagaagctttgatgcttagaggattagaggcgcaga 390
Query: 311 tacgacaaaatcacccccatctccgttga 339
| || ||||| || || ||||||||||||
Sbjct: 391 tccgtcaaaaccatcctcatctccgttga 419