Miyakogusa Predicted Gene

Lj0g3v0314389.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj0g3v0314389.1 tr|Q2HV99|Q2HV99_MEDTR Protein kinase; Type I EGF
OS=Medicago truncatula GN=MTR_2g009670 PE=4 SV=1,34.74,6e-19,seg,NULL;
coiled-coil,NULL; GUB_WAK_bind,Wall-associated receptor kinase
galacturonan-binding domain,CUFF.21242.1
         (1098 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|GO010898 similar to UniRef100_Q2HV99 Cluster: Protein k...    54   2e-06

>gnl|LJGI|GO010898 similar to UniRef100_Q2HV99 Cluster: Protein kinase; Type I EGF;
           n=1; Medicago truncatula|Rep: Protein kinase; Type I EGF
           - Medicago truncatula (Barrel medic), partial (29%)
          Length = 665

 Score = 54.0 bits (27), Expect = 2e-06
 Identities = 66/79 (83%)
 Strand = Plus / Plus

                                                                       
Query: 481 tcccaaatcattcataggaatgtggtcaaactcttgggatgctgtttggagactgaagta 540
           ||||||||||  |||||||||||||| ||  ||||||| || ||||| ||||| ||||| 
Sbjct: 225 tcccaaatcaaccataggaatgtggtgaagatcttggggtgttgtttagagacagaagtt 284

                              
Query: 541 cctttactagtttatgagt 559
           || || || ||||||||||
Sbjct: 285 ccattgcttgtttatgagt 303