Miyakogusa Predicted Gene

Lj0g3v0313469.1

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj0g3v0313469.1 Non Chatacterized Hit- tr|I1N2D6|I1N2D6_SOYBN
Uncharacterized protein OS=Glycine max PE=4
SV=1,86.32,0,PROTEIN_KINASE_ATP,Protein kinase, ATP binding site;
PROTEIN_KINASE_ST,Serine/threonine-protein kina,CUFF.21185.1
         (2595 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|BW598395 similar to UniRef100_Q5GHF7 Cluster: Adenylate...   258   2e-67
gnl|LJGI|TC58946 similar to UniRef100_A7QKS1 Cluster: Chromosome...   113   6e-24
gnl|LJGI|NP7225959 GB|DQ436462.1|ABD93932.1 adenylate isopenteny...    54   5e-06

>gnl|LJGI|BW598395 similar to UniRef100_Q5GHF7 Cluster: Adenylate
           isopentenyltransferase; n=1; Humulus lupulus|Rep:
           Adenylate isopentenyltransferase - Humulus lupulus
           (European hop), partial (7%)
          Length = 485

 Score =  258 bits (130), Expect = 2e-67
 Identities = 130/130 (100%)
 Strand = Plus / Plus

                                                                       
Query: 1   atggatgggtcgacttcgccgaggaggtgggggacggcgttgcgctggtggggtgagatc 60
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 249 atggatgggtcgacttcgccgaggaggtgggggacggcgttgcgctggtggggtgagatc 308

                                                                       
Query: 61  ttgttggttgtgatttcaggtatgaagttgaaagtctttggatctgggaaagttggagtc 120
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 309 ttgttggttgtgatttcaggtatgaagttgaaagtctttggatctgggaaagttggagtc 368

                     
Query: 121 tttggacctg 130
           ||||||||||
Sbjct: 369 tttggacctg 378


>gnl|LJGI|TC58946 similar to UniRef100_A7QKS1 Cluster: Chromosome undetermined
            scaffold_114, whole genome shotgun sequence; n=1; Vitis
            vinifera|Rep: Chromosome undetermined scaffold_114, whole
            genome shotgun sequence - Vitis vinifera (Grape), partial
            (13%)
          Length = 845

 Score =  113 bits (57), Expect = 6e-24
 Identities = 141/169 (83%)
 Strand = Plus / Plus

                                                                        
Query: 2074 gctggttcctatggttacatagctcctgagtatggctacatcatgaagataacagagaaa 2133
            |||||||||||||| || || ||||| || |||||||||||  ||||||| |||||||| 
Sbjct: 6    gctggttcctatggatatattgctccagaatatggctacatgttgaagatcacagagaag 65

                                                                        
Query: 2134 agtgatgtttacagctatggtattgttgtgttagaggtactaacagggaagcaaccaatt 2193
            ||||| ||||||||||||||| | ||  || | || ||  | ||||| ||||||||||||
Sbjct: 66   agtgacgtttacagctatggtgtggtgttgctggaagtcttgacaggtaagcaaccaatt 125

                                                             
Query: 2194 gatccaacaatccctgatggactgcatattgttgattgggtaagacaga 2242
            |||||||| || || ||||| || ||| ||||||||||||| |||||||
Sbjct: 126  gatccaaccataccagatggtctacatgttgttgattgggtgagacaga 174


>gnl|LJGI|NP7225959 GB|DQ436462.1|ABD93932.1 adenylate isopentenyltransferase
          Length = 1335

 Score = 54.0 bits (27), Expect = 5e-06
 Identities = 56/65 (86%), Gaps = 3/65 (4%)
 Strand = Plus / Minus

                                                                       
Query: 7   gggtcgacttcgccgaggaggtgg---gggacggcgttgcgctggtggggtgagatcttg 63
           |||||||| |||||||||||||||   ||||||  |||||| ||||| |||| |||||||
Sbjct: 334 gggtcgacgtcgccgaggaggtggtgggggacgttgttgcgttggtgaggtgggatcttg 275

                
Query: 64  ttggt 68
           |||||
Sbjct: 274 ttggt 270