Miyakogusa Predicted Gene

Lj0g3v0313449.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj0g3v0313449.1 tr|A9TNB3|A9TNB3_PHYPA Eukaryotic translation
initiation factor 3 subunit G OS=Physcomitrella
patens,33.73,0.00001,RRM,RNA recognition motif domain; seg,NULL;
RRM_1,RNA recognition motif domain; no description,Nucle,CUFF.21164.1
         (621 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|BW626410                                                      96   3e-19

>gnl|LJGI|BW626410 
          Length = 485

 Score = 95.6 bits (48), Expect = 3e-19
 Identities = 147/180 (81%)
 Strand = Plus / Plus

                                                                       
Query: 248 ttaccctcttcgttgacggcatcgaggaggcaatcagctatcacaatatcaggggcctct 307
           |||| ||||| ||||||||||| || |||| |||| | || ||| ||||| ||||||| |
Sbjct: 269 ttactctctttgttgacggcattgaagaggaaatcggttaccaccatatccggggccttt 328

                                                                       
Query: 308 tctccctgtttggatccatctctagggtctttgttcaacgaactcataatcttgggaggc 367
           ||||| |||||||| || | || ||||| |||||||||||   || |||  | |||||||
Sbjct: 329 tctccttgtttggaaccctttcaagggtttttgttcaacgttatcgtaagttcgggaggc 388

                                                                       
Query: 368 ggtttcagtttggcttcgtccattttctcacccggaagcaagcctattctacaattgatg 427
           | ||||  || ||||| || ||||||||| ||||||||||||||| |||| |||||||||
Sbjct: 389 gatttcgcttcggctttgttcattttctctcccggaagcaagcctcttctgcaattgatg 448