Miyakogusa Predicted Gene

Lj0g3v0313219.2
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj0g3v0313219.2 Non Chatacterized Hit- tr|D7KNH9|D7KNH9_ARALL
Putative uncharacterized protein OS=Arabidopsis lyrata,34.45,2e-18,Bet
v1-like,NULL; DUF220,Protein of unknown function DUF220; FAMILY NOT
NAMED,NULL,CUFF.21148.2
         (1017 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|GO036671                                                     168   4e-41

>gnl|LJGI|GO036671 
          Length = 642

 Score =  168 bits (85), Expect = 4e-41
 Identities = 95/97 (97%), Gaps = 1/97 (1%)
 Strand = Plus / Plus

                                                                       
Query: 1   atggatgagtcagagattaccaagttcagcttaaatgtcaagaaggatgaaaaagatggg 60
           |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||
Sbjct: 546 atggatgagtcagagattaccaagttcagcttaaatgtcaagaaagatgaaaaagatggg 605

                                                
Query: 61  tcccc-aaggggattgaatccagcaatctctaaattt 96
           ||||| |||||||||||||||||||||||||||||||
Sbjct: 606 tccccaaaggggattgaatccagcaatctctaaattt 642