Miyakogusa Predicted Gene

Lj0g3v0313199.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj0g3v0313199.1 Non Chatacterized Hit- tr|B9SLI2|B9SLI2_RICCO
Putative uncharacterized protein OS=Ricinus communis
G,45.76,0.000000002,seg,NULL,CUFF.21145.1
         (850 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|GO004998 homologue to UniRef100_A6R6T3 Cluster: Predict...   252   3e-66

>gnl|LJGI|GO004998 homologue to UniRef100_A6R6T3 Cluster: Predicted protein; n=1;
           Ajellomyces capsulatus NAm1|Rep: Predicted protein -
           Ajellomyces, partial (1%)
          Length = 636

 Score =  252 bits (127), Expect = 3e-66
 Identities = 144/152 (94%)
 Strand = Plus / Minus

                                                                       
Query: 1   atgggtagagaaccagtgagggttttctttaaggatgaaaaannnnnnnatttttgctat 60
           ||||||||||||||||||||||||||||||||| ||||||||       |||||||||||
Sbjct: 152 atgggtagagaaccagtgagggttttctttaagtatgaaaaattgggggatttttgctat 93

                                                                       
Query: 61  gggtgtggaatgctagaccatactcttagggactgtgatgagaaacaagatgattggaat 120
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 92  gggtgtggaatgctagaccatactcttagggactgtgatgagaaacaagatgattggaat 33

                                           
Query: 121 gagaaagatgatgaggggatgccttttggtgt 152
           ||||||||||||||||||||||||||||||||
Sbjct: 32  gagaaagatgatgaggggatgccttttggtgt 1