Miyakogusa Predicted Gene

Lj0g3v0312579.1

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj0g3v0312579.1 tr|G3ECQ9|G3ECQ9_SOYBN Rsmv23 protein OS=Glycine
max GN=Gma.43849 PE=2 SV=1,70.93,0,seg,NULL; Pkinase,Protein kinase,
catalytic domain; PROTEIN_KINASE_DOM,Protein kinase, catalytic
dom,CUFF.21091.1
         (699 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC58104 similar to UniRef100_O23190 Cluster: MAP3K-like...    56   3e-07

>gnl|LJGI|TC58104 similar to UniRef100_O23190 Cluster: MAP3K-like protein kinase;
           n=1; Arabidopsis thaliana|Rep: MAP3K-like protein kinase
           - Arabidopsis thaliana (Mouse-ear cress), partial (17%)
          Length = 803

 Score = 56.0 bits (28), Expect = 3e-07
 Identities = 49/56 (87%)
 Strand = Plus / Plus

                                                                   
Query: 525 tgggctctggggtgtgcggtggtggagatggtgtccgggaagccggcgtggaatgt 580
           |||||||| || || || ||||| ||||||||| |||| |||||||||||||||||
Sbjct: 627 tgggctctcggctgcgccgtggttgagatggtgaccggaaagccggcgtggaatgt 682