Miyakogusa Predicted Gene
- Lj0g3v0312559.1
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj0g3v0312559.1 Non Chatacterized Hit- tr|I1K248|I1K248_SOYBN
Uncharacterized protein OS=Glycine max PE=4 SV=1,75.24,0,LEA_2,Late
embryogenesis abundant protein, LEA-14; seg,NULL,CUFF.21089.1
(972 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|BP045611 similar to UniRef100_A7NTX9 Cluster: Chromosom... 444 e-124
gnl|LJGI|BI417327 weakly similar to UniRef100_Q84VY4 Cluster: At... 60 3e-08
gnl|LJGI|TC73012 similar to UniRef100_Q84VY4 Cluster: At5g42860;... 60 3e-08
gnl|LJGI|TC58291 similar to UniRef100_Q84VY4 Cluster: At5g42860;... 60 3e-08
>gnl|LJGI|BP045611 similar to UniRef100_A7NTX9 Cluster: Chromosome chr18 scaffold_1,
whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
Chromosome chr18 scaffold_1, whole genome shotgun
sequence - Vitis vinifera (Grape), partial (41%)
Length = 570
Score = 444 bits (224), Expect = e-124
Identities = 227/228 (99%)
Strand = Plus / Minus
Query: 745 cacattcccttgtacggagggggagcgagcttgagcagcacgagtggcggggcgccggcg 804
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 570 cacattcccttgtacggagggggagcgagcttgagcagcacgagtggcggggcgccggcg 511
Query: 805 gaggcgctgccattgaagttgagagtgatggtgaggtcaaggggttatgtgttagggaaa 864
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 510 gaggcgctgccattgaagttgagagtgatggtgaggtcaaggggttatgtgttagggaaa 451
Query: 865 ttggtgaagccaaagttcaacaagaagattgagtgcagcgtggttatggatccgaagaag 924
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 450 ttggtgaagcccaagttcaacaagaagattgagtgcagcgtggttatggatccgaagaag 391
Query: 925 atgggtgcgcccgtttcgctagtgaacaagtgcatttacgagtgaagt 972
||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 390 atgggtgcgcccgtttcgctagtgaacaagtgcatttacgagtgaagt 343
>gnl|LJGI|BI417327 weakly similar to UniRef100_Q84VY4 Cluster: At5g42860; n=1;
Arabidopsis thaliana|Rep: At5g42860 - Arabidopsis
thaliana (Mouse-ear cress), partial (27%)
Length = 515
Score = 60.0 bits (30), Expect = 3e-08
Identities = 45/50 (90%)
Strand = Plus / Plus
Query: 422 tcctcctcttctccttcttcgctctcattctctggggcgctagccggccc 471
||||||||||||| ||||||||||||| |||||||| |||||| |||||
Sbjct: 291 tcctcctcttctctctcttcgctctcatcctctggggtgctagcaggccc 340
>gnl|LJGI|TC73012 similar to UniRef100_Q84VY4 Cluster: At5g42860; n=1; Arabidopsis
thaliana|Rep: At5g42860 - Arabidopsis thaliana
(Mouse-ear cress), partial (41%)
Length = 954
Score = 60.0 bits (30), Expect = 3e-08
Identities = 45/50 (90%)
Strand = Plus / Plus
Query: 422 tcctcctcttctccttcttcgctctcattctctggggcgctagccggccc 471
||||||||||||| ||||||||||||| |||||||| |||||| |||||
Sbjct: 680 tcctcctcttctctctcttcgctctcatcctctggggtgctagcaggccc 729
>gnl|LJGI|TC58291 similar to UniRef100_Q84VY4 Cluster: At5g42860; n=1; Arabidopsis
thaliana|Rep: At5g42860 - Arabidopsis thaliana
(Mouse-ear cress), partial (71%)
Length = 1457
Score = 60.0 bits (30), Expect = 3e-08
Identities = 45/50 (90%)
Strand = Plus / Plus
Query: 422 tcctcctcttctccttcttcgctctcattctctggggcgctagccggccc 471
||||||||||||| ||||||||||||| |||||||| |||||| |||||
Sbjct: 514 tcctcctcttctctctcttcgctctcatcctctggggtgctagcaggccc 563