Miyakogusa Predicted Gene

Lj0g3v0312559.1
Show Alignment: 

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj0g3v0312559.1 Non Chatacterized Hit- tr|I1K248|I1K248_SOYBN
Uncharacterized protein OS=Glycine max PE=4 SV=1,75.24,0,LEA_2,Late
embryogenesis abundant protein, LEA-14; seg,NULL,CUFF.21089.1
         (972 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|BP045611 similar to UniRef100_A7NTX9 Cluster: Chromosom...   444   e-124
gnl|LJGI|BI417327 weakly similar to UniRef100_Q84VY4 Cluster: At...    60   3e-08
gnl|LJGI|TC73012 similar to UniRef100_Q84VY4 Cluster: At5g42860;...    60   3e-08
gnl|LJGI|TC58291 similar to UniRef100_Q84VY4 Cluster: At5g42860;...    60   3e-08

>gnl|LJGI|BP045611 similar to UniRef100_A7NTX9 Cluster: Chromosome chr18 scaffold_1,
           whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
           Chromosome chr18 scaffold_1, whole genome shotgun
           sequence - Vitis vinifera (Grape), partial (41%)
          Length = 570

 Score =  444 bits (224), Expect = e-124
 Identities = 227/228 (99%)
 Strand = Plus / Minus

                                                                       
Query: 745 cacattcccttgtacggagggggagcgagcttgagcagcacgagtggcggggcgccggcg 804
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 570 cacattcccttgtacggagggggagcgagcttgagcagcacgagtggcggggcgccggcg 511

                                                                       
Query: 805 gaggcgctgccattgaagttgagagtgatggtgaggtcaaggggttatgtgttagggaaa 864
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 510 gaggcgctgccattgaagttgagagtgatggtgaggtcaaggggttatgtgttagggaaa 451

                                                                       
Query: 865 ttggtgaagccaaagttcaacaagaagattgagtgcagcgtggttatggatccgaagaag 924
           ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 450 ttggtgaagcccaagttcaacaagaagattgagtgcagcgtggttatggatccgaagaag 391

                                                           
Query: 925 atgggtgcgcccgtttcgctagtgaacaagtgcatttacgagtgaagt 972
           ||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 390 atgggtgcgcccgtttcgctagtgaacaagtgcatttacgagtgaagt 343


>gnl|LJGI|BI417327 weakly similar to UniRef100_Q84VY4 Cluster: At5g42860; n=1;
           Arabidopsis thaliana|Rep: At5g42860 - Arabidopsis
           thaliana (Mouse-ear cress), partial (27%)
          Length = 515

 Score = 60.0 bits (30), Expect = 3e-08
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                             
Query: 422 tcctcctcttctccttcttcgctctcattctctggggcgctagccggccc 471
           |||||||||||||  ||||||||||||| |||||||| |||||| |||||
Sbjct: 291 tcctcctcttctctctcttcgctctcatcctctggggtgctagcaggccc 340


>gnl|LJGI|TC73012 similar to UniRef100_Q84VY4 Cluster: At5g42860; n=1; Arabidopsis
           thaliana|Rep: At5g42860 - Arabidopsis thaliana
           (Mouse-ear cress), partial (41%)
          Length = 954

 Score = 60.0 bits (30), Expect = 3e-08
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                             
Query: 422 tcctcctcttctccttcttcgctctcattctctggggcgctagccggccc 471
           |||||||||||||  ||||||||||||| |||||||| |||||| |||||
Sbjct: 680 tcctcctcttctctctcttcgctctcatcctctggggtgctagcaggccc 729


>gnl|LJGI|TC58291 similar to UniRef100_Q84VY4 Cluster: At5g42860; n=1; Arabidopsis
           thaliana|Rep: At5g42860 - Arabidopsis thaliana
           (Mouse-ear cress), partial (71%)
          Length = 1457

 Score = 60.0 bits (30), Expect = 3e-08
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                             
Query: 422 tcctcctcttctccttcttcgctctcattctctggggcgctagccggccc 471
           |||||||||||||  ||||||||||||| |||||||| |||||| |||||
Sbjct: 514 tcctcctcttctctctcttcgctctcatcctctggggtgctagcaggccc 563