Miyakogusa Predicted Gene

Lj0g3v0312429.2
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj0g3v0312429.2 Non Chatacterized Hit- tr|F6GTM1|F6GTM1_VITVI
Putative uncharacterized protein OS=Vitis vinifera
GN=,80.28,0,FKS1_dom1,1,3-beta-glucan synthase subunit FKS1-like,
domain-1; SUBFAMILY NOT NAMED,Callose synthase,CUFF.21079.2
         (1512 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|GO014028 similar to UniRef100_UPI00001623CC Cluster: AT...   101   1e-20
gnl|LJGI|FS347580 similar to UniRef100_A7P003 Cluster: Chromosom...    56   7e-07

>gnl|LJGI|GO014028 similar to UniRef100_UPI00001623CC Cluster: ATGSL08 (GLUCAN
           SYNTHASE-LIKE 8); 1,3-beta-glucan synthase/ transferase,
           transferring glycosyl groups; n=1; Arabidopsis
           thaliana|Rep: ATGSL08 (GLUCAN SYNTHASE-LIKE 8);
           1,3-beta-glucan synthase/ transferase, transferring
           glycosyl groups - Arabidopsis thaliana, partial (3%)
          Length = 674

 Score =  101 bits (51), Expect = 1e-20
 Identities = 51/51 (100%)
 Strand = Plus / Minus

                                                              
Query: 1   atgatagcaaatgcacaatctcgacttggcataccagctgaaactgatcca 51
           |||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 565 atgatagcaaatgcacaatctcgacttggcataccagctgaaactgatcca 515


>gnl|LJGI|FS347580 similar to UniRef100_A7P003 Cluster: Chromosome chr6 scaffold_3,
           whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
           Chromosome chr6 scaffold_3, whole genome shotgun
           sequence - Vitis vinifera (Grape), partial (13%)
          Length = 638

 Score = 56.0 bits (28), Expect = 7e-07
 Identities = 46/52 (88%)
 Strand = Plus / Minus

                                                               
Query: 438 atggaggaactatgatgactttaatgaatacttctggtcgcctgcttgtttt 489
           |||||||||||||||||| || |||||||| ||||||||  ||| |||||||
Sbjct: 287 atggaggaactatgatgatttaaatgaatatttctggtctgctgattgtttt 236