Miyakogusa Predicted Gene

Lj0g3v0309809.1
Show Alignment: 

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj0g3v0309809.1 Non Chatacterized Hit- tr|I3T378|I3T378_LOTJA
Uncharacterized protein OS=Lotus japonicus PE=4 SV=1,92.31,1e-18,
,NODE_53309_length_295_cov_81.189827.path2.1
         (160 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC60149                                                      309   3e-84
gnl|LJGI|TC67005                                                      301   6e-82
gnl|LJGI|GO016766 similar to UniRef100_P29828 Cluster: Protein d...   285   4e-77
gnl|LJGI|TC76084 similar to UniRef100_A7QS14 Cluster: Chromosome...   100   5e-21
gnl|LJGI|TC76818                                                       90   5e-18
gnl|LJGI|BP084782 similar to UniRef100_Q4SJ93 Cluster: Chromosom...    80   4e-15
gnl|LJGI|BP078838                                                      76   7e-14

>gnl|LJGI|TC60149 
          Length = 825

 Score =  309 bits (156), Expect = 3e-84
 Identities = 159/160 (99%)
 Strand = Plus / Plus

                                                                       
Query: 1   atggcactgcccattaaggttatccaaaggcctaagtcacttgatttaggagtgcaattc 60
           ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||
Sbjct: 413 atggcactgcccattaaggttatcccaaggcctaagtcacttgatttaggagtgcaattc 472

                                                                       
Query: 61  tctagcagccctgatgagccagccactgagggagctatgatcaagtcttcaagaattggt 120
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 473 tctagcagccctgatgagccagccactgagggagctatgatcaagtcttcaagaattggt 532

                                                   
Query: 121 gctttggaaaacataccaaagaatttggatcaaagatgat 160
           ||||||||||||||||||||||||||||||||||||||||
Sbjct: 533 gctttggaaaacataccaaagaatttggatcaaagatgat 572


>gnl|LJGI|TC67005 
          Length = 1733

 Score =  301 bits (152), Expect = 6e-82
 Identities = 158/160 (98%)
 Strand = Plus / Plus

                                                                        
Query: 1    atggcactgcccattaaggttatccaaaggcctaagtcacttgatttaggagtgcaattc 60
            ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||
Sbjct: 1302 atggcactgcccattaaggttatcccaaggcctaagtcacttgatttaggagtgcaattc 1361

                                                                        
Query: 61   tctagcagccctgatgagccagccactgagggagctatgatcaagtcttcaagaattggt 120
            |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct: 1362 tctagcagccctgatgagccagccactgagggagctgtgatcaagtcttcaagaattggt 1421

                                                    
Query: 121  gctttggaaaacataccaaagaatttggatcaaagatgat 160
            ||||||||||||||||||||||||||||||||||||||||
Sbjct: 1422 gctttggaaaacataccaaagaatttggatcaaagatgat 1461


>gnl|LJGI|GO016766 similar to UniRef100_P29828 Cluster: Protein disulfide-isomerase
           precursor; n=1; Medicago sativa|Rep: Protein
           disulfide-isomerase precursor - Medicago sativa
           (Alfalfa), partial (14%)
          Length = 937

 Score =  285 bits (144), Expect = 4e-77
 Identities = 156/160 (97%)
 Strand = Plus / Minus

                                                                       
Query: 1   atggcactgcccattaaggttatccaaaggcctaagtcacttgatttaggagtgcaattc 60
           |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||
Sbjct: 728 atggcactgcccattaaggttatccaaaggcctaagtcacctgatttaggagtgcaattc 669

                                                                       
Query: 61  tctagcagccctgatgagccagccactgagggagctatgatcaagtcttcaagaattggt 120
           |||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||
Sbjct: 668 tctagcagccctgatgagccagccactgagggagctgtgatcgagtcttcaagaattggt 609

                                                   
Query: 121 gctttggaaaacataccaaagaatttggatcaaagatgat 160
           ||||||||||||||||||||||||||||||| ||||||||
Sbjct: 608 gctttggaaaacataccaaagaatttggatcgaagatgat 569


>gnl|LJGI|TC76084 similar to UniRef100_A7QS14 Cluster: Chromosome undetermined
           scaffold_155, whole genome shotgun sequence; n=1; Vitis
           vinifera|Rep: Chromosome undetermined scaffold_155,
           whole genome shotgun sequence - Vitis vinifera (Grape),
           partial (10%)
          Length = 927

 Score = 99.6 bits (50), Expect = 5e-21
 Identities = 80/90 (88%)
 Strand = Plus / Plus

                                                                       
Query: 1   atggcactgcccattaaggttatccaaaggcctaagtcacttgatttaggagtgcaattc 60
           ||||||| ||||||| ||||||| ||||||||||| ||||||| ||| || ||| |||||
Sbjct: 216 atggcacagcccattgaggttatacaaaggcctaaatcacttggtttgggtgtggaattc 275

                                         
Query: 61  tctagcagccctgatgagccagccactgag 90
           ||||| | ||||||||||||||||||||||
Sbjct: 276 tctagtaaccctgatgagccagccactgag 305


>gnl|LJGI|TC76818 
          Length = 620

 Score = 89.7 bits (45), Expect = 5e-18
 Identities = 106/125 (84%), Gaps = 1/125 (0%)
 Strand = Plus / Plus

                                                                       
Query: 1   atggcactgcccattaaggttatccaaaggcctaagtcacttgatttaggagtgcaattc 60
           ||||| |||||| || ||||||| | |||||| | |||||||||||||||| ||| ||||
Sbjct: 224 atggccctgccccttgaggttattccaaggccca-gtcacttgatttaggaatgccattc 282

                                                                       
Query: 61  tctagcagccctgatgagccagccactgagggagctatgatcaagtcttcaagaattggt 120
           | |||| |||||||||||| ||||  |||| |||||| |||| ||| ||| |||||||||
Sbjct: 283 tttagccgccctgatgagctagcctttgagtgagctaggatccagttttccagaattggt 342

                
Query: 121 gcttt 125
           |||||
Sbjct: 343 gcttt 347


>gnl|LJGI|BP084782 similar to UniRef100_Q4SJ93 Cluster: Chromosome 4 SCAF14575, whole
           genome shotgun sequence; n=1; Tetraodon
           nigroviridis|Rep: Chromosome 4 SCAF14575, whole genome
           shotgun sequence - Tetraodon nigroviridis (Green
           puffer), partial (7%)
          Length = 502

 Score = 79.8 bits (40), Expect = 4e-15
 Identities = 67/76 (88%)
 Strand = Plus / Minus

                                                                       
Query: 85  actgagggagctatgatcaagtcttcaagaattggtgctttggaaaacataccaaagaat 144
           ||||||| ||||| ||  |||||||||||| |||||||||||||||| ||||| |||| |
Sbjct: 271 actgaggtagctaggaggaagtcttcaagatttggtgctttggaaaatatacccaagatt 212

                           
Query: 145 ttggatcaaagatgat 160
           ||||||||||| ||||
Sbjct: 211 ttggatcaaaggtgat 196


>gnl|LJGI|BP078838 
          Length = 473

 Score = 75.8 bits (38), Expect = 7e-14
 Identities = 53/58 (91%)
 Strand = Plus / Minus

                                                                     
Query: 103 aagtcttcaagaattggtgctttggaaaacataccaaagaatttggatcaaagatgat 160
           |||||||||| |||||||||||||||| |||||||||||| || ||||||||| ||||
Sbjct: 410 aagtcttcaaaaattggtgctttggaagacataccaaagatttgggatcaaaggtgat 353