Miyakogusa Predicted Gene

Lj0g3v0306419.1
Show Alignment: 

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj0g3v0306419.1 tr|H9BVM7|H9BVM7_LOTJA Nodulation pectate lyase
mutant OS=Lotus japonicus GN=NPL PE=4 SV=1,100,0,no description,Pectin
lyase fold; SUBFAMILY NOT NAMED,NULL; FAMILY NOT NAMED,NULL; no
description,Pe,CUFF.20646.1
         (1203 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC61678 similar to UniRef100_Q2Z1Y4 Cluster: Pectate ly...   100   4e-20
gnl|LJGI|TC65970 similar to UniRef100_Q2Z1Y4 Cluster: Pectate ly...    92   1e-17
gnl|LJGI|GO032618 similar to UniRef100_A7PCL8 Cluster: Chromosom...    82   9e-15
gnl|LJGI|GO036714 similar to UniRef100_A4GU24 Cluster: Pectate l...    72   9e-12
gnl|LJGI|TC75071 similar to UniRef100_A7PLX6 Cluster: Chromosome...    68   1e-10
gnl|LJGI|BP072134 similar to UniRef100_A7PLX6 Cluster: Chromosom...    64   2e-09
gnl|LJGI|TC66981 similar to UniRef100_A7NXS8 Cluster: Chromosome...    56   5e-07
gnl|LJGI|GO036854 similar to UniRef100_UPI0000048239 Cluster: pe...    52   8e-06
gnl|LJGI|TC77984 similar to UniRef100_Q40319 Cluster: Pectate ly...    52   8e-06

>gnl|LJGI|TC61678 similar to UniRef100_Q2Z1Y4 Cluster: Pectate lyase; n=1; Prunus
           mume|Rep: Pectate lyase - Prunus mume (Japanese
           flowering apricot), partial (96%)
          Length = 1633

 Score = 99.6 bits (50), Expect = 4e-20
 Identities = 206/258 (79%)
 Strand = Plus / Plus

                                                                       
Query: 618 gagcaatgtttgggtggaccattgttctttgtcgaactgttttgatgggttgattgatgt 677
           |||| |||| |||||||||||||| |||||||| ||||||  |||||||||||| || | 
Sbjct: 701 gagccatgtctgggtggaccattgctctttgtctaactgtaatgatgggttgatcgacgc 760

                                                                       
Query: 678 tgttcatggatcaacggctattaccatttcgaacaattacatgacgcaccataacaaggt 737
             | ||||| || ||||| |||||||| || ||||||||||||||||||||| | |||||
Sbjct: 761 catccatggttccacggcgattaccatctctaacaattacatgacgcaccatgataaggt 820

                                                                       
Query: 738 catgctcttgggtcatagtgattccaataaagaggataaaaagatgcaggttacgattgc 797
           ||||||  |||| || || |||    | |   | || || || |||||||| || |||||
Sbjct: 821 catgctgctgggccacagcgatggttacacccaagacaagaacatgcaggtcaccattgc 880

                                                                       
Query: 798 tttcaaccattttggagaaggacttgggggaagaatgcccaggtgcaggttcggatattt 857
           ||| ||||| ||||| ||||| ||||    ||||||||| |||||||||   ||||||||
Sbjct: 881 ttttaaccactttggtgaaggtcttgttcaaagaatgccaaggtgcaggcatggatattt 940

                             
Query: 858 ccacgtggtgaacaatga 875
            || ||||||||||||||
Sbjct: 941 tcatgtggtgaacaatga 958



 Score = 65.9 bits (33), Expect = 5e-10
 Identities = 84/101 (83%)
 Strand = Plus / Plus

                                                                       
Query: 406 atgaactcttacaagaccattgatggtagaggagctaatgtccacattgctggagggcct 465
           |||||||| | ||||||||||||||| |||||||| | ||| ||||| ||||| ||||| 
Sbjct: 489 atgaactcgttcaagaccattgatggaagaggagcgagtgtgcacatcgctggtgggccc 548

                                                    
Query: 466 tgcatcaaggtgcagagaaagaccaacatcataatccatgg 506
           ||||||| ||| |||     |||||||||||| ||||||||
Sbjct: 549 tgcatcacggttcagtatgtgaccaacatcatcatccatgg 589



 Score = 52.0 bits (26), Expect = 8e-06
 Identities = 62/74 (83%)
 Strand = Plus / Plus

                                                                       
Query: 154 aaccccattgatgattgttggaggtgcgaccccaattgggaaaacaaccgcaaacggcta 213
           ||||||||||||||||| |||||||| ||||| || ||||| || ||| |  |  |||||
Sbjct: 234 aaccccattgatgattgctggaggtgtgacccaaactgggagaagaacaggcagaggcta 293

                         
Query: 214 gcagaatgtgcaat 227
           ||||| ||||||||
Sbjct: 294 gcagactgtgcaat 307


>gnl|LJGI|TC65970 similar to UniRef100_Q2Z1Y4 Cluster: Pectate lyase; n=1; Prunus
           mume|Rep: Pectate lyase - Prunus mume (Japanese
           flowering apricot), partial (92%)
          Length = 1915

 Score = 91.7 bits (46), Expect = 1e-17
 Identities = 202/254 (79%)
 Strand = Plus / Plus

                                                                       
Query: 628 tgggtggaccattgttctttgtcgaactgttttgatgggttgattgatgttgttcatgga 687
           |||||||||||||| || |||||||| ||    ||||| ||||| ||||   ||||||| 
Sbjct: 708 tgggtggaccattgctcgttgtcgaattgcaaggatggattgatcgatgcgattcatggg 767

                                                                       
Query: 688 tcaacggctattaccatttcgaacaattacatgacgcaccataacaaggtcatgctcttg 747
           || || || |||||||| || |||||||||||||| |||||| | || |||||| | |||
Sbjct: 768 tccaccgcaattaccatatccaacaattacatgactcaccatgataaagtcatgttgttg 827

                                                                       
Query: 748 ggtcatagtgattccaataaagaggataaaaagatgcaggttacgattgctttcaaccat 807
           ||||| || |||||  | | ||| || || || ||||| || || || ||||||||||| 
Sbjct: 828 ggtcacagcgattcttacacagatgacaagaacatgcaagtcacaatcgctttcaaccac 887

                                                                       
Query: 808 tttggagaaggacttgggggaagaatgcccaggtgcaggttcggatatttccacgtggtg 867
           ||||| ||||| ||||    ||||||||| ||||| ||| | ||||| ||||| ||||||
Sbjct: 888 tttggtgaaggtcttgttcaaagaatgccaaggtgtaggcttggatacttccatgtggtg 947

                         
Query: 868 aacaatgattacac 881
           |||||||| |||||
Sbjct: 948 aacaatgactacac 961



 Score = 67.9 bits (34), Expect = 1e-10
 Identities = 64/74 (86%)
 Strand = Plus / Plus

                                                                       
Query: 154 aaccccattgatgattgttggaggtgcgaccccaattgggaaaacaaccgcaaacggcta 213
           ||||| ||||||||||| |||||||| ||| |||||||||| |||||  | ||| |||||
Sbjct: 231 aaccctattgatgattgctggaggtgtgacaccaattgggagaacaataggaaaaggcta 290

                         
Query: 214 gcagaatgtgcaat 227
           ||||| ||||||||
Sbjct: 291 gcagattgtgcaat 304


>gnl|LJGI|GO032618 similar to UniRef100_A7PCL8 Cluster: Chromosome chr17 scaffold_12,
           whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
           Chromosome chr17 scaffold_12, whole genome shotgun
           sequence - Vitis vinifera (Grape), partial (42%)
          Length = 714

 Score = 81.8 bits (41), Expect = 9e-15
 Identities = 50/53 (94%)
 Strand = Plus / Plus

                                                                
Query: 709 aacaattacatgacgcaccataacaaggtcatgctcttgggtcatagtgattc 761
           |||||||||||||| |||||||||||||||||||| ||||| |||||||||||
Sbjct: 19  aacaattacatgacccaccataacaaggtcatgcttttgggccatagtgattc 71


>gnl|LJGI|GO036714 similar to UniRef100_A4GU24 Cluster: Pectate lyase precursor; n=1;
           Glycine max|Rep: Pectate lyase precursor - Glycine max
           (Soybean), partial (75%)
          Length = 784

 Score = 71.9 bits (36), Expect = 9e-12
 Identities = 94/112 (83%), Gaps = 1/112 (0%)
 Strand = Plus / Plus

                                                                       
Query: 618 gagcaatgtttgggtggaccattgttctttgtcgaactgttttgatgggttgattgatgt 677
           |||| |||| |||||||||||||| |||||||| ||||||  |||||||||||| || | 
Sbjct: 630 gagccatgtctgggtggaccattgctctttgtctaactgtaatgatgggttgatcgacgc 689

                                                               
Query: 678 tgttcatggatcaacggctattaccatttcgaacaattacatgacgcaccat 729
             | ||||| || || || |||||||| || |||||||||||||||||||||
Sbjct: 690 catccatggttccac-gcgattaccatctctaacaattacatgacgcaccat 740


>gnl|LJGI|TC75071 similar to UniRef100_A7PLX6 Cluster: Chromosome chr14 scaffold_21,
           whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
           Chromosome chr14 scaffold_21, whole genome shotgun
           sequence - Vitis vinifera (Grape), partial (36%)
          Length = 525

 Score = 67.9 bits (34), Expect = 1e-10
 Identities = 97/118 (82%)
 Strand = Plus / Plus

                                                                       
Query: 121 agaaaattgggtttttattcatgtggaacaggcaaccccattgatgattgttggaggtgc 180
           ||||| ||||||| ||  ||||||||||| || || ||||||||||| || ||| | || 
Sbjct: 190 agaaacttgggttatttatcatgtggaaccggtaatcccattgatgactgctggcgatgt 249

                                                                     
Query: 181 gaccccaattgggaaaacaaccgcaaacggctagcagaatgtgcaatcgggtttggca 238
           ||||| |||||||| ||||||||  || |||||||||| || || || ||||||||||
Sbjct: 250 gaccctaattgggagaacaaccggcaaaggctagcagattgcgccattgggtttggca 307


>gnl|LJGI|BP072134 similar to UniRef100_A7PLX6 Cluster: Chromosome chr14 scaffold_21,
           whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
           Chromosome chr14 scaffold_21, whole genome shotgun
           sequence - Vitis vinifera (Grape), partial (28%)
          Length = 382

 Score = 63.9 bits (32), Expect = 2e-09
 Identities = 83/100 (83%)
 Strand = Plus / Plus

                                                                       
Query: 139 tcatgtggaacaggcaaccccattgatgattgttggaggtgcgaccccaattgggaaaac 198
           ||||||||||| || || ||||||||||| || ||| | || ||||| |||||||| |||
Sbjct: 65  tcatgtggaaccggtaatcccattgatgactgctggcgatgtgaccctaattgggagaac 124

                                                   
Query: 199 aaccgcaaacggctagcagaatgtgcaatcgggtttggca 238
           |||||  || |||||||||| || || || ||||||||||
Sbjct: 125 aaccggcaaaggctagcagattgcgccattgggtttggca 164


>gnl|LJGI|TC66981 similar to UniRef100_A7NXS8 Cluster: Chromosome chr5 scaffold_2,
           whole genome shotgun sequence; n=2; Vitis vinifera|Rep:
           Chromosome chr5 scaffold_2, whole genome shotgun
           sequence - Vitis vinifera (Grape), partial (37%)
          Length = 779

 Score = 56.0 bits (28), Expect = 5e-07
 Identities = 37/40 (92%)
 Strand = Plus / Plus

                                                   
Query: 417 caagaccattgatggtagaggagctaatgtccacattgct 456
           |||||| |||||||| |||||||| |||||||||||||||
Sbjct: 696 caagacaattgatggcagaggagccaatgtccacattgct 735


>gnl|LJGI|GO036854 similar to UniRef100_UPI0000048239 Cluster: pectate lyase family
           protein; n=1; Arabidopsis thaliana|Rep: pectate lyase
           family protein - Arabidopsis thaliana, partial (50%)
          Length = 785

 Score = 52.0 bits (26), Expect = 8e-06
 Identities = 29/30 (96%)
 Strand = Plus / Plus

                                         
Query: 414 ttacaagaccattgatggtagaggagctaa 443
           ||||||||| ||||||||||||||||||||
Sbjct: 422 ttacaagacaattgatggtagaggagctaa 451


>gnl|LJGI|TC77984 similar to UniRef100_Q40319 Cluster: Pectate lyase homolog; n=6;
           Medicago sativa|Rep: Pectate lyase homolog - Medicago
           sativa (Alfalfa), partial (90%)
          Length = 1455

 Score = 52.0 bits (26), Expect = 8e-06
 Identities = 50/58 (86%)
 Strand = Plus / Plus

                                                                     
Query: 857 tccacgtggtgaacaatgattacacacattggcagaagtacgcaataggtgggagttc 914
           |||| ||| |||||||||| ||||| ||||||| || |||||| || |||||||||||
Sbjct: 916 tccatgtgttgaacaatgactacacccattggctgatgtacgcgattggtgggagttc 973