Miyakogusa Predicted Gene
- Lj0g3v0306419.1
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj0g3v0306419.1 tr|H9BVM7|H9BVM7_LOTJA Nodulation pectate lyase
mutant OS=Lotus japonicus GN=NPL PE=4 SV=1,100,0,no description,Pectin
lyase fold; SUBFAMILY NOT NAMED,NULL; FAMILY NOT NAMED,NULL; no
description,Pe,CUFF.20646.1
(1203 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|TC61678 similar to UniRef100_Q2Z1Y4 Cluster: Pectate ly... 100 4e-20
gnl|LJGI|TC65970 similar to UniRef100_Q2Z1Y4 Cluster: Pectate ly... 92 1e-17
gnl|LJGI|GO032618 similar to UniRef100_A7PCL8 Cluster: Chromosom... 82 9e-15
gnl|LJGI|GO036714 similar to UniRef100_A4GU24 Cluster: Pectate l... 72 9e-12
gnl|LJGI|TC75071 similar to UniRef100_A7PLX6 Cluster: Chromosome... 68 1e-10
gnl|LJGI|BP072134 similar to UniRef100_A7PLX6 Cluster: Chromosom... 64 2e-09
gnl|LJGI|TC66981 similar to UniRef100_A7NXS8 Cluster: Chromosome... 56 5e-07
gnl|LJGI|GO036854 similar to UniRef100_UPI0000048239 Cluster: pe... 52 8e-06
gnl|LJGI|TC77984 similar to UniRef100_Q40319 Cluster: Pectate ly... 52 8e-06
>gnl|LJGI|TC61678 similar to UniRef100_Q2Z1Y4 Cluster: Pectate lyase; n=1; Prunus
mume|Rep: Pectate lyase - Prunus mume (Japanese
flowering apricot), partial (96%)
Length = 1633
Score = 99.6 bits (50), Expect = 4e-20
Identities = 206/258 (79%)
Strand = Plus / Plus
Query: 618 gagcaatgtttgggtggaccattgttctttgtcgaactgttttgatgggttgattgatgt 677
|||| |||| |||||||||||||| |||||||| |||||| |||||||||||| || |
Sbjct: 701 gagccatgtctgggtggaccattgctctttgtctaactgtaatgatgggttgatcgacgc 760
Query: 678 tgttcatggatcaacggctattaccatttcgaacaattacatgacgcaccataacaaggt 737
| ||||| || ||||| |||||||| || ||||||||||||||||||||| | |||||
Sbjct: 761 catccatggttccacggcgattaccatctctaacaattacatgacgcaccatgataaggt 820
Query: 738 catgctcttgggtcatagtgattccaataaagaggataaaaagatgcaggttacgattgc 797
|||||| |||| || || ||| | | | || || || |||||||| || |||||
Sbjct: 821 catgctgctgggccacagcgatggttacacccaagacaagaacatgcaggtcaccattgc 880
Query: 798 tttcaaccattttggagaaggacttgggggaagaatgcccaggtgcaggttcggatattt 857
||| ||||| ||||| ||||| |||| ||||||||| ||||||||| ||||||||
Sbjct: 881 ttttaaccactttggtgaaggtcttgttcaaagaatgccaaggtgcaggcatggatattt 940
Query: 858 ccacgtggtgaacaatga 875
|| ||||||||||||||
Sbjct: 941 tcatgtggtgaacaatga 958
Score = 65.9 bits (33), Expect = 5e-10
Identities = 84/101 (83%)
Strand = Plus / Plus
Query: 406 atgaactcttacaagaccattgatggtagaggagctaatgtccacattgctggagggcct 465
|||||||| | ||||||||||||||| |||||||| | ||| ||||| ||||| |||||
Sbjct: 489 atgaactcgttcaagaccattgatggaagaggagcgagtgtgcacatcgctggtgggccc 548
Query: 466 tgcatcaaggtgcagagaaagaccaacatcataatccatgg 506
||||||| ||| ||| |||||||||||| ||||||||
Sbjct: 549 tgcatcacggttcagtatgtgaccaacatcatcatccatgg 589
Score = 52.0 bits (26), Expect = 8e-06
Identities = 62/74 (83%)
Strand = Plus / Plus
Query: 154 aaccccattgatgattgttggaggtgcgaccccaattgggaaaacaaccgcaaacggcta 213
||||||||||||||||| |||||||| ||||| || ||||| || ||| | | |||||
Sbjct: 234 aaccccattgatgattgctggaggtgtgacccaaactgggagaagaacaggcagaggcta 293
Query: 214 gcagaatgtgcaat 227
||||| ||||||||
Sbjct: 294 gcagactgtgcaat 307
>gnl|LJGI|TC65970 similar to UniRef100_Q2Z1Y4 Cluster: Pectate lyase; n=1; Prunus
mume|Rep: Pectate lyase - Prunus mume (Japanese
flowering apricot), partial (92%)
Length = 1915
Score = 91.7 bits (46), Expect = 1e-17
Identities = 202/254 (79%)
Strand = Plus / Plus
Query: 628 tgggtggaccattgttctttgtcgaactgttttgatgggttgattgatgttgttcatgga 687
|||||||||||||| || |||||||| || ||||| ||||| |||| |||||||
Sbjct: 708 tgggtggaccattgctcgttgtcgaattgcaaggatggattgatcgatgcgattcatggg 767
Query: 688 tcaacggctattaccatttcgaacaattacatgacgcaccataacaaggtcatgctcttg 747
|| || || |||||||| || |||||||||||||| |||||| | || |||||| | |||
Sbjct: 768 tccaccgcaattaccatatccaacaattacatgactcaccatgataaagtcatgttgttg 827
Query: 748 ggtcatagtgattccaataaagaggataaaaagatgcaggttacgattgctttcaaccat 807
||||| || ||||| | | ||| || || || ||||| || || || |||||||||||
Sbjct: 828 ggtcacagcgattcttacacagatgacaagaacatgcaagtcacaatcgctttcaaccac 887
Query: 808 tttggagaaggacttgggggaagaatgcccaggtgcaggttcggatatttccacgtggtg 867
||||| ||||| |||| ||||||||| ||||| ||| | ||||| ||||| ||||||
Sbjct: 888 tttggtgaaggtcttgttcaaagaatgccaaggtgtaggcttggatacttccatgtggtg 947
Query: 868 aacaatgattacac 881
|||||||| |||||
Sbjct: 948 aacaatgactacac 961
Score = 67.9 bits (34), Expect = 1e-10
Identities = 64/74 (86%)
Strand = Plus / Plus
Query: 154 aaccccattgatgattgttggaggtgcgaccccaattgggaaaacaaccgcaaacggcta 213
||||| ||||||||||| |||||||| ||| |||||||||| ||||| | ||| |||||
Sbjct: 231 aaccctattgatgattgctggaggtgtgacaccaattgggagaacaataggaaaaggcta 290
Query: 214 gcagaatgtgcaat 227
||||| ||||||||
Sbjct: 291 gcagattgtgcaat 304
>gnl|LJGI|GO032618 similar to UniRef100_A7PCL8 Cluster: Chromosome chr17 scaffold_12,
whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
Chromosome chr17 scaffold_12, whole genome shotgun
sequence - Vitis vinifera (Grape), partial (42%)
Length = 714
Score = 81.8 bits (41), Expect = 9e-15
Identities = 50/53 (94%)
Strand = Plus / Plus
Query: 709 aacaattacatgacgcaccataacaaggtcatgctcttgggtcatagtgattc 761
|||||||||||||| |||||||||||||||||||| ||||| |||||||||||
Sbjct: 19 aacaattacatgacccaccataacaaggtcatgcttttgggccatagtgattc 71
>gnl|LJGI|GO036714 similar to UniRef100_A4GU24 Cluster: Pectate lyase precursor; n=1;
Glycine max|Rep: Pectate lyase precursor - Glycine max
(Soybean), partial (75%)
Length = 784
Score = 71.9 bits (36), Expect = 9e-12
Identities = 94/112 (83%), Gaps = 1/112 (0%)
Strand = Plus / Plus
Query: 618 gagcaatgtttgggtggaccattgttctttgtcgaactgttttgatgggttgattgatgt 677
|||| |||| |||||||||||||| |||||||| |||||| |||||||||||| || |
Sbjct: 630 gagccatgtctgggtggaccattgctctttgtctaactgtaatgatgggttgatcgacgc 689
Query: 678 tgttcatggatcaacggctattaccatttcgaacaattacatgacgcaccat 729
| ||||| || || || |||||||| || |||||||||||||||||||||
Sbjct: 690 catccatggttccac-gcgattaccatctctaacaattacatgacgcaccat 740
>gnl|LJGI|TC75071 similar to UniRef100_A7PLX6 Cluster: Chromosome chr14 scaffold_21,
whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
Chromosome chr14 scaffold_21, whole genome shotgun
sequence - Vitis vinifera (Grape), partial (36%)
Length = 525
Score = 67.9 bits (34), Expect = 1e-10
Identities = 97/118 (82%)
Strand = Plus / Plus
Query: 121 agaaaattgggtttttattcatgtggaacaggcaaccccattgatgattgttggaggtgc 180
||||| ||||||| || ||||||||||| || || ||||||||||| || ||| | ||
Sbjct: 190 agaaacttgggttatttatcatgtggaaccggtaatcccattgatgactgctggcgatgt 249
Query: 181 gaccccaattgggaaaacaaccgcaaacggctagcagaatgtgcaatcgggtttggca 238
||||| |||||||| |||||||| || |||||||||| || || || ||||||||||
Sbjct: 250 gaccctaattgggagaacaaccggcaaaggctagcagattgcgccattgggtttggca 307
>gnl|LJGI|BP072134 similar to UniRef100_A7PLX6 Cluster: Chromosome chr14 scaffold_21,
whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
Chromosome chr14 scaffold_21, whole genome shotgun
sequence - Vitis vinifera (Grape), partial (28%)
Length = 382
Score = 63.9 bits (32), Expect = 2e-09
Identities = 83/100 (83%)
Strand = Plus / Plus
Query: 139 tcatgtggaacaggcaaccccattgatgattgttggaggtgcgaccccaattgggaaaac 198
||||||||||| || || ||||||||||| || ||| | || ||||| |||||||| |||
Sbjct: 65 tcatgtggaaccggtaatcccattgatgactgctggcgatgtgaccctaattgggagaac 124
Query: 199 aaccgcaaacggctagcagaatgtgcaatcgggtttggca 238
||||| || |||||||||| || || || ||||||||||
Sbjct: 125 aaccggcaaaggctagcagattgcgccattgggtttggca 164
>gnl|LJGI|TC66981 similar to UniRef100_A7NXS8 Cluster: Chromosome chr5 scaffold_2,
whole genome shotgun sequence; n=2; Vitis vinifera|Rep:
Chromosome chr5 scaffold_2, whole genome shotgun
sequence - Vitis vinifera (Grape), partial (37%)
Length = 779
Score = 56.0 bits (28), Expect = 5e-07
Identities = 37/40 (92%)
Strand = Plus / Plus
Query: 417 caagaccattgatggtagaggagctaatgtccacattgct 456
|||||| |||||||| |||||||| |||||||||||||||
Sbjct: 696 caagacaattgatggcagaggagccaatgtccacattgct 735
>gnl|LJGI|GO036854 similar to UniRef100_UPI0000048239 Cluster: pectate lyase family
protein; n=1; Arabidopsis thaliana|Rep: pectate lyase
family protein - Arabidopsis thaliana, partial (50%)
Length = 785
Score = 52.0 bits (26), Expect = 8e-06
Identities = 29/30 (96%)
Strand = Plus / Plus
Query: 414 ttacaagaccattgatggtagaggagctaa 443
||||||||| ||||||||||||||||||||
Sbjct: 422 ttacaagacaattgatggtagaggagctaa 451
>gnl|LJGI|TC77984 similar to UniRef100_Q40319 Cluster: Pectate lyase homolog; n=6;
Medicago sativa|Rep: Pectate lyase homolog - Medicago
sativa (Alfalfa), partial (90%)
Length = 1455
Score = 52.0 bits (26), Expect = 8e-06
Identities = 50/58 (86%)
Strand = Plus / Plus
Query: 857 tccacgtggtgaacaatgattacacacattggcagaagtacgcaataggtgggagttc 914
|||| ||| |||||||||| ||||| ||||||| || |||||| || |||||||||||
Sbjct: 916 tccatgtgttgaacaatgactacacccattggctgatgtacgcgattggtgggagttc 973