Miyakogusa Predicted Gene
- Lj0g3v0306279.1
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj0g3v0306279.1 tr|F4HV88|F4HV88_ARATH Ribosomal protein L18ae
family protein OS=Arabidopsis thaliana GN=At1g54217 P,59.38,2e-19,60S
RIBOSOMAL PROTEIN L18A-RELATED,NULL; 60S RIBOSOMAL PROTEIN
L18A,Ribosomal protein L18a; seg,NULL,CUFF.20635.1
(294 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|GO011707 68 3e-11
gnl|LJGI|TC62633 68 3e-11
gnl|LJGI|TC61350 68 3e-11
>gnl|LJGI|GO011707
Length = 723
Score = 67.9 bits (34), Expect = 3e-11
Identities = 103/126 (81%)
Strand = Plus / Plus
Query: 75 tgacaagccacttccatgttttggttgtggaattggatggttctcttttctgcttggatt 134
|||||| || || |||||||||||||| ||| ||||||||||||| ||||| ||||||
Sbjct: 361 tgacaaacctctcccatgttttggttgcggagttggatggttctcatttctttgtggatt 420
Query: 135 tgcgttcccactgatgtggtattatgctacaattctctactttggaaattactatcgcaa 194
| | |||| ||||||| || || ||||| ||||| |||||||||||||| |||||
Sbjct: 421 tttatgtccacctctgtggtactacgcaacaatcctctattttggaaattactaccgcaa 480
Query: 195 ggatcc 200
||||||
Sbjct: 481 ggatcc 486
>gnl|LJGI|TC62633
Length = 903
Score = 67.9 bits (34), Expect = 3e-11
Identities = 103/126 (81%)
Strand = Plus / Plus
Query: 75 tgacaagccacttccatgttttggttgtggaattggatggttctcttttctgcttggatt 134
|||||| || || |||||||||||||| ||| ||||||||||||| ||||| ||||||
Sbjct: 293 tgacaaacctctcccatgttttggttgcggagttggatggttctcatttctttgtggatt 352
Query: 135 tgcgttcccactgatgtggtattatgctacaattctctactttggaaattactatcgcaa 194
| | |||| ||||||| || || ||||| ||||| |||||||||||||| |||||
Sbjct: 353 tttatgtccacctctgtggtactacgcaacaatcctctattttggaaattactaccgcaa 412
Query: 195 ggatcc 200
||||||
Sbjct: 413 ggatcc 418
>gnl|LJGI|TC61350
Length = 841
Score = 67.9 bits (34), Expect = 3e-11
Identities = 103/126 (81%)
Strand = Plus / Plus
Query: 75 tgacaagccacttccatgttttggttgtggaattggatggttctcttttctgcttggatt 134
|||||| || || |||||||||||||| ||| ||||||||||||| ||||| ||||||
Sbjct: 363 tgacaaacctctcccatgttttggttgcggagttggatggttctcatttctttgtggatt 422
Query: 135 tgcgttcccactgatgtggtattatgctacaattctctactttggaaattactatcgcaa 194
| | |||| ||||||| || || ||||| ||||| |||||||||||||| |||||
Sbjct: 423 tttatgtccacctctgtggtactacgcaacaatcctctattttggaaattactaccgcaa 482
Query: 195 ggatcc 200
||||||
Sbjct: 483 ggatcc 488