Miyakogusa Predicted Gene

Lj0g3v0306239.1
Show Alignment:  
BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj0g3v0306239.1 Non Chatacterized Hit- tr|I1LML3|I1LML3_SOYBN
Uncharacterized protein OS=Glycine max PE=4 SV=1,83.33,2e-19,seg,NULL;
Guanylate_cyc_2,Guanylyl cyclase,CUFF.20630.1
         (186 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC70213 similar to UniRef100_A0FK53 Cluster: Guanylyl c...   369   e-102

>gnl|LJGI|TC70213 similar to UniRef100_A0FK53 Cluster: Guanylyl cyclase; n=1; Glycine
           max|Rep: Guanylyl cyclase - Glycine max (Soybean),
           partial (51%)
          Length = 1176

 Score =  369 bits (186), Expect = e-102
 Identities = 186/186 (100%)
 Strand = Plus / Plus

                                                                       
Query: 1   atgtttgagattagagatcctgcgagctctaagaaacaaaagaggatctcttcaaagtcc 60
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 634 atgtttgagattagagatcctgcgagctctaagaaacaaaagaggatctcttcaaagtcc 693

                                                                       
Query: 61  ttagaagaagctcgtaaagcctttggtactgatgaagatcttttgttgatatcattggag 120
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 694 ttagaagaagctcgtaaagcctttggtactgatgaagatcttttgttgatatcattggag 753

                                                                       
Query: 121 aagagcaacaaccatcaccaaccttctctgcaaccttccatcgatttcaaaactgattct 180
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 754 aagagcaacaaccatcaccaaccttctctgcaaccttccatcgatttcaaaactgattct 813

                 
Query: 181 tgattt 186
           ||||||
Sbjct: 814 tgattt 819