Miyakogusa Predicted Gene

Lj0g3v0304679.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj0g3v0304679.1 Non Chatacterized Hit- tr|D7L9M0|D7L9M0_ARALL
Putative uncharacterized protein (Fragment)
OS=Arabido,54.43,0.0000000000005,seg,NULL; TPX2,Xklp2 targeting
protein,CUFF.20497.1
         (354 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|GO030430                                                      70   1e-11

>gnl|LJGI|GO030430 
          Length = 129

 Score = 69.9 bits (35), Expect = 1e-11
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                             
Query: 1  atgagatccccggttataacatctcctttcaactt 35
          |||||||||||||||||||||||||||||||||||
Sbjct: 50 atgagatccccggttataacatctcctttcaactt 16