Miyakogusa Predicted Gene
- Lj0g3v0304279.1
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj0g3v0304279.1 Non Chatacterized Hit- tr|I1LPV6|I1LPV6_SOYBN
Uncharacterized protein OS=Glycine max PE=4 SV=1,81.11,1e-37,FAMILY
NOT NAMED,NULL; Auxin_inducible,Auxin responsive SAUR
protein,CUFF.20470.1
(277 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|GO028197 similar to UniRef100_P33083 Cluster: Auxin-ind... 143 6e-34
gnl|LJGI|TC69658 similar to UniRef100_P33080 Cluster: Auxin-indu... 139 1e-32
gnl|LJGI|GO020496 similar to UniRef100_P33081 Cluster: Auxin-ind... 119 9e-27
gnl|LJGI|TC75973 similar to UniRef100_P33079 Cluster: Auxin-indu... 90 8e-18
gnl|LJGI|TC72127 similar to UniRef100_P33079 Cluster: Auxin-indu... 74 5e-13
gnl|LJGI|TC61031 similar to UniRef100_P33080 Cluster: Auxin-indu... 58 3e-08
gnl|LJGI|GO024625 similar to UniRef100_A7PV82 Cluster: Chromosom... 56 1e-07
gnl|LJGI|TC65689 similar to UniRef100_A7P831 Cluster: Chromosome... 56 1e-07
gnl|LJGI|GO009789 similar to UniRef100_P33079 Cluster: Auxin-ind... 52 2e-06
>gnl|LJGI|GO028197 similar to UniRef100_P33083 Cluster: Auxin-induced protein 6B; n=1;
Glycine max|Rep: Auxin-induced protein 6B - Glycine max
(Soybean), complete
Length = 494
Score = 143 bits (72), Expect = 6e-34
Identities = 162/192 (84%)
Strand = Plus / Minus
Query: 48 ccaagcatcttcaaaatctgttgatgtgccaaagggctatcttgcagtttatgttggaga 107
||||||| |||||||||||||| | || | ||||||||||||||||| |||||||||||
Sbjct: 341 ccaagcagcttcaaaatctgttaaagtttcgaagggctatcttgcagtgtatgttggaga 282
Query: 108 ggaaatgaagaggtttgtgatccccatatcatacttgagtcaaacttcattccaagagtt 167
||| |||||||||||| ||||| |||||||||||| ||| ||||||| ||||| ||
Sbjct: 281 agaacagaagaggtttgtaatccctgtatcatacttgaaccaaccttcatttcaagaatt 222
Query: 168 gttgaaccaagctgaggaacaatttgggtatgaccatccaatgggtggtctaacaattcc 227
| ||| ||||||||||| | ||||| ||||| ||||| |||||||| || ||||||||
Sbjct: 221 gctgagtcaagctgaggacgagtttggatatgatcatcccatgggtggcctcacaattcc 162
Query: 228 ttgcagagaaga 239
|||||| |||||
Sbjct: 161 ttgcagcgaaga 150
>gnl|LJGI|TC69658 similar to UniRef100_P33080 Cluster: Auxin-induced protein X10A;
n=1; Glycine max|Rep: Auxin-induced protein X10A -
Glycine max (Soybean), partial (80%)
Length = 528
Score = 139 bits (70), Expect = 1e-32
Identities = 157/186 (84%)
Strand = Plus / Plus
Query: 48 ccaagcatcttcaaaatctgttgatgtgccaaagggctatcttgcagtttatgttggaga 107
||||||| |||||||||||| || ||||||||||| ||||||||||| |||||||||||
Sbjct: 139 ccaagcagcttcaaaatctgcagaagtgccaaagggatatcttgcagtgtatgttggaga 198
Query: 108 ggaaatgaagaggtttgtgatccccatatcatacttgagtcaaacttcattccaagagtt 167
||| |||| ||||||||||||| ||||||||| ||| ||| ||||||| ||||||||
Sbjct: 199 taaaacgaagcggtttgtgatccctatatcatacctgaaccaaccttcatttcaagagtt 258
Query: 168 gttgaaccaagctgaggaacaatttgggtatgaccatccaatgggtggtctaacaattcc 227
| | ||||| || ||| ||||||| ||||| |||||||| |||||||| ||||||||
Sbjct: 259 actacatcaagccgaagaagaatttggatatgatcatccaataggtggtctcacaattcc 318
Query: 228 ttgcag 233
|||||
Sbjct: 319 atgcag 324
>gnl|LJGI|GO020496 similar to UniRef100_P33081 Cluster: Auxin-induced protein 15A;
n=1; Glycine max|Rep: Auxin-induced protein 15A -
Glycine max (Soybean), partial (90%)
Length = 494
Score = 119 bits (60), Expect = 9e-27
Identities = 138/164 (84%)
Strand = Plus / Plus
Query: 76 ccaaagggctatcttgcagtttatgttggagaggaaatgaagaggtttgtgatccccata 135
||||| |||||||||||||| ||||||| |||| ||||||| ||||||||||||||||
Sbjct: 173 ccaaaaggctatcttgcagtctatgttgcagagaaaatgaaacggtttgtgatccccatt 232
Query: 136 tcatacttgagtcaaacttcattccaagagttgttgaaccaagctgaggaacaatttggg 195
|||||| ||| |||| ||||||| ||||| | || | ||||||||| ||| ||| ||
Sbjct: 233 tcatacctgaatcaaccttcatttcaagaactattaagccaagctgaagaaaaatacgga 292
Query: 196 tatgaccatccaatgggtggtctaacaattccttgcagagaaga 239
||||| |||||| |||||||||| |||||||||||| ||||||
Sbjct: 293 tatgatcatccagtgggtggtctcgcaattccttgcaaagaaga 336
>gnl|LJGI|TC75973 similar to UniRef100_P33079 Cluster: Auxin-induced protein 10A5;
n=1; Glycine max|Rep: Auxin-induced protein 10A5 -
Glycine max (Soybean), partial (90%)
Length = 491
Score = 89.7 bits (45), Expect = 8e-18
Identities = 117/141 (82%)
Strand = Plus / Plus
Query: 86 atcttgcagtttatgttggagaggaaatgaagaggtttgtgatccccatatcatacttga 145
|||||||||| ||||||||||| ||||||| | |||||||||| || ||||||||||||
Sbjct: 188 atcttgcagtctatgttggagatgaaatgaggcggtttgtgattccagtatcatacttga 247
Query: 146 gtcaaacttcattccaagagttgttgaaccaagctgaggaacaatttgggtatgaccatc 205
||| |||| || |||||||| || | ||||| || ||| ||||||| ||||| ||||
Sbjct: 248 accaaccttcttttcaagagttactgcatcaagcagaagaagaatttggatatgatcatc 307
Query: 206 caatgggtggtctaacaattc 226
||| |||||||| |||||||
Sbjct: 308 caacaggtggtctcacaattc 328
>gnl|LJGI|TC72127 similar to UniRef100_P33079 Cluster: Auxin-induced protein 10A5;
n=1; Glycine max|Rep: Auxin-induced protein 10A5 -
Glycine max (Soybean), partial (91%)
Length = 523
Score = 73.8 bits (37), Expect = 5e-13
Identities = 109/133 (81%)
Strand = Plus / Plus
Query: 76 ccaaagggctatcttgcagtttatgttggagaggaaatgaagaggtttgtgatccccata 135
||||| ||| |||||||||| ||||||||||| ||||||| | |||| ||||| || ||
Sbjct: 177 ccaaaaggccatcttgcagtctatgttggagatgaaatgaggcggttcgtgattccagta 236
Query: 136 tcatacttgagtcaaacttcattccaagagttgttgaaccaagctgaggaacaatttggg 195
|||||||||| ||| ||||||| |||||||| | | ||||| || ||| |||||||
Sbjct: 237 tcatacttgaaccaaccttcatttcaagagttactatatcaagccgaagaagaatttgga 296
Query: 196 tatgaccatccaa 208
||||| |||||||
Sbjct: 297 tatgatcatccaa 309
>gnl|LJGI|TC61031 similar to UniRef100_P33080 Cluster: Auxin-induced protein X10A;
n=1; Glycine max|Rep: Auxin-induced protein X10A -
Glycine max (Soybean), partial (88%)
Length = 764
Score = 58.0 bits (29), Expect = 3e-08
Identities = 56/65 (86%)
Strand = Plus / Plus
Query: 175 caagctgaggaacaatttgggtatgaccatccaatgggtggtctaacaattccttgcaga 234
|||||||||||| | ||||| |||||||||| | ||||||||| || |||||||||||
Sbjct: 564 caagctgaggaagagtttggatatgaccatcacacgggtggtctcacgattccttgcagt 623
Query: 235 gaaga 239
|||||
Sbjct: 624 gaaga 628
>gnl|LJGI|GO024625 similar to UniRef100_A7PV82 Cluster: Chromosome chr4 scaffold_32,
whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
Chromosome chr4 scaffold_32, whole genome shotgun
sequence - Vitis vinifera (Grape), partial (67%)
Length = 621
Score = 56.0 bits (28), Expect = 1e-07
Identities = 34/36 (94%)
Strand = Plus / Plus
Query: 205 ccaatgggtggtctaacaattccttgcagagaagag 240
|||||||||||||| |||||||||||||| ||||||
Sbjct: 362 ccaatgggtggtctcacaattccttgcagtgaagag 397
>gnl|LJGI|TC65689 similar to UniRef100_A7P831 Cluster: Chromosome chr3 scaffold_8,
whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
Chromosome chr3 scaffold_8, whole genome shotgun
sequence - Vitis vinifera (Grape), partial (64%)
Length = 636
Score = 56.0 bits (28), Expect = 1e-07
Identities = 34/36 (94%)
Strand = Plus / Plus
Query: 205 ccaatgggtggtctaacaattccttgcagagaagag 240
|||||||||||||| |||||||||||||| ||||||
Sbjct: 325 ccaatgggtggtctcacaattccttgcagtgaagag 360
>gnl|LJGI|GO009789 similar to UniRef100_P33079 Cluster: Auxin-induced protein 10A5;
n=1; Glycine max|Rep: Auxin-induced protein 10A5 -
Glycine max (Soybean), complete
Length = 499
Score = 52.0 bits (26), Expect = 2e-06
Identities = 125/158 (79%)
Strand = Plus / Plus
Query: 76 ccaaagggctatcttgcagtttatgttggagaggaaatgaagaggtttgtgatccccata 135
||||| ||||| |||||||| ||||||||||| |||||| |||| ||||| ||| ||
Sbjct: 179 ccaaaaggctaccttgcagtctatgttggagataaaatgagacggttcgtgattcccgta 238
Query: 136 tcatacttgagtcaaacttcattccaagagttgttgaaccaagctgaggaacaatttggg 195
||| |||||| ||| ||||| | |||||||| | | ||||| || ||| | |||||
Sbjct: 239 tcacacttgaaccaaccttcacttcaagagttactacatcaagcagaagaagagtttgga 298
Query: 196 tatgaccatccaatgggtggtctaacaattccttgcag 233
|||||||||||| || ||||| |||||||| |||||
Sbjct: 299 tatgaccatccagcaggcggtcttacaattccatgcag 336