Miyakogusa Predicted Gene

Lj0g3v0303129.5
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj0g3v0303129.5 Non Chatacterized Hit- tr|B9SVH8|B9SVH8_RICCO
Cystathionine gamma-synthase, putative (Fragment) OS=R,81.48,3e-18,no
description,Pyridoxal phosphate-dependent transferase, major region,
subdomain 1; CYSTATHIONINE G,CUFF.20376.5
         (249 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC58818 similar to UniRef100_Q9XFG0 Cluster: Cystathion...   240   3e-63

>gnl|LJGI|TC58818 similar to UniRef100_Q9XFG0 Cluster: Cystathionine-gamma-synthase
            precursor; n=2; Papilionoideae|Rep:
            Cystathionine-gamma-synthase precursor - Glycine max
            (Soybean), partial (90%)
          Length = 1822

 Score =  240 bits (121), Expect = 3e-63
 Identities = 130/133 (97%)
 Strand = Plus / Plus

                                                                        
Query: 86   ctctgttcttcactgagtctcctaccaatccattcctccgatgtgttgacattaagctgg 145
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 923  ctctgttcttcactgagtctcctaccaatccattcctccgatgtgttgacattaagctgg 982

                                                                        
Query: 146  tttcagagctttgccaccggaatggggctttggtctgcattgatggtacatttgcatcac 205
            |||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||
Sbjct: 983  tttcagagctttgccaccggaatggggctttgctctgcattgatggtacatttgcaacac 1042

                         
Query: 206  ttttgaaccagaa 218
             ||||||||||||
Sbjct: 1043 ctttgaaccagaa 1055



 Score =  133 bits (67), Expect = 5e-31
 Identities = 79/83 (95%)
 Strand = Plus / Plus

                                                                        
Query: 1    atgaaaatgctgcatctctgtgtacagcagcagaattccactgcattaaggatggcgaaa 60
            ||||||| |||||||||| |||||||||||||||||||||| |||||||||||||| |||
Sbjct: 1237 atgaaaacgctgcatctccgtgtacagcagcagaattccacagcattaaggatggccaaa 1296

                                   
Query: 61   cttttagaggcacatcccaaggt 83
            |||||||||||||||||||||||
Sbjct: 1297 cttttagaggcacatcccaaggt 1319