Miyakogusa Predicted Gene
- Lj0g3v0303059.1
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj0g3v0303059.1 tr|G7KT01|G7KT01_MEDTR Importin-7 OS=Medicago
truncatula GN=MTR_7g021500 PE=4 SV=1,94.92,0,no
description,Armadillo-like helical; Cse1,Exportin/Importin, Cse1-like;
IMPORTIN 7, 8 (IMP7, 8) (R,CUFF.20388.1
(840 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|BU494412 homologue to UniRef100_A7Q9N9 Cluster: Chromos... 210 1e-53
>gnl|LJGI|BU494412 homologue to UniRef100_A7Q9N9 Cluster: Chromosome chr5 scaffold_67,
whole genome shotgun sequence; n=2; Vitis vinifera|Rep:
Chromosome chr5 scaffold_67, whole genome shotgun
sequence - Vitis vinifera (Grape), partial (11%)
Length = 329
Score = 210 bits (106), Expect = 1e-53
Identities = 106/106 (100%)
Strand = Plus / Plus
Query: 658 gacaaattgaagcagtccgagccgtacaaatctgaacttgagcgtatgttagtgcaacat 717
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1 gacaaattgaagcagtccgagccgtacaaatctgaacttgagcgtatgttagtgcaacat 60
Query: 718 gtctttcctgagtttaacagtcctgttggccaccttagagctaagg 763
||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 61 gtctttcctgagtttaacagtcctgttggccaccttagagctaagg 106