Miyakogusa Predicted Gene

Lj0g3v0302799.2
Show Alignment: 

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj0g3v0302799.2 Non Chatacterized Hit- tr|I1J7C8|I1J7C8_SOYBN
Uncharacterized protein OS=Glycine max GN=Gma.55472
PE,91.3,4e-19,seg,NULL,CUFF.20671.2
         (213 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC70115 homologue to UniRef100_A0EVX1 Cluster: EBP1; n=...   218   1e-56
gnl|LJGI|TC59748 homologue to UniRef100_A0EVX1 Cluster: EBP1; n=...   218   1e-56
gnl|LJGI|TC78511 homologue to UniRef100_A0EVX1 Cluster: EBP1; n=...   135   1e-31

>gnl|LJGI|TC70115 homologue to UniRef100_A0EVX1 Cluster: EBP1; n=1; Ammopiptanthus
           mongolicus|Rep: EBP1 - Ammopiptanthus mongolicus,
           partial (20%)
          Length = 517

 Score =  218 bits (110), Expect = 1e-56
 Identities = 110/110 (100%)
 Strand = Plus / Plus

                                                                       
Query: 1   atgcccaacggatcagaccgtatcacatctcatccactccaggaattgcagaccactaaa 60
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 83  atgcccaacggatcagaccgtatcacatctcatccactccaggaattgcagaccactaaa 142

                                                             
Query: 61  acagttgaagatcctgaaattaaggcctggctagcattgggcaccaagtc 110
           ||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 143 acagttgaagatcctgaaattaaggcctggctagcattgggcaccaagtc 192



 Score =  125 bits (63), Expect = 1e-28
 Identities = 63/63 (100%)
 Strand = Plus / Plus

                                                                       
Query: 151 ggggctgaagctgagcctgtggaggcaacaaatggtgccactccacaagagcaagattga 210
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 233 ggggctgaagctgagcctgtggaggcaacaaatggtgccactccacaagagcaagattga 292

              
Query: 211 gtg 213
           |||
Sbjct: 293 gtg 295


>gnl|LJGI|TC59748 homologue to UniRef100_A0EVX1 Cluster: EBP1; n=1; Ammopiptanthus
            mongolicus|Rep: EBP1 - Ammopiptanthus mongolicus, partial
            (86%)
          Length = 1401

 Score =  218 bits (110), Expect = 1e-56
 Identities = 110/110 (100%)
 Strand = Plus / Plus

                                                                        
Query: 1    atgcccaacggatcagaccgtatcacatctcatccactccaggaattgcagaccactaaa 60
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1015 atgcccaacggatcagaccgtatcacatctcatccactccaggaattgcagaccactaaa 1074

                                                              
Query: 61   acagttgaagatcctgaaattaaggcctggctagcattgggcaccaagtc 110
            ||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1075 acagttgaagatcctgaaattaaggcctggctagcattgggcaccaagtc 1124



 Score =  125 bits (63), Expect = 1e-28
 Identities = 63/63 (100%)
 Strand = Plus / Plus

                                                                        
Query: 151  ggggctgaagctgagcctgtggaggcaacaaatggtgccactccacaagagcaagattga 210
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1165 ggggctgaagctgagcctgtggaggcaacaaatggtgccactccacaagagcaagattga 1224

               
Query: 211  gtg 213
            |||
Sbjct: 1225 gtg 1227


>gnl|LJGI|TC78511 homologue to UniRef100_A0EVX1 Cluster: EBP1; n=1; Ammopiptanthus
           mongolicus|Rep: EBP1 - Ammopiptanthus mongolicus,
           partial (63%)
          Length = 1008

 Score =  135 bits (68), Expect = 1e-31
 Identities = 95/104 (91%)
 Strand = Plus / Plus

                                                                       
Query: 1   atgcccaacggatcagaccgtatcacatctcatccactccaggaattgcagaccactaaa 60
           ||||| || |||||||| ||||||||||| ||||||||||||||||||||| | || |||
Sbjct: 541 atgccaaatggatcagatcgtatcacatcacatccactccaggaattgcagcctacaaaa 600

                                                       
Query: 61  acagttgaagatcctgaaattaaggcctggctagcattgggcac 104
           ||||||||||||||||| |||||||||||||||||| |||||||
Sbjct: 601 acagttgaagatcctgagattaaggcctggctagcactgggcac 644



 Score =  109 bits (55), Expect = 7e-24
 Identities = 61/63 (96%)
 Strand = Plus / Plus

                                                                       
Query: 151 ggggctgaagctgagcctgtggaggcaacaaatggtgccactccacaagagcaagattga 210
           |||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||
Sbjct: 691 ggggctgaagctgagcctgtggagtcaacaaatggtgcaactccacaagagcaagattga 750

              
Query: 211 gtg 213
           |||
Sbjct: 751 gtg 753