Miyakogusa Predicted Gene
- Lj0g3v0302799.2
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj0g3v0302799.2 Non Chatacterized Hit- tr|I1J7C8|I1J7C8_SOYBN
Uncharacterized protein OS=Glycine max GN=Gma.55472
PE,91.3,4e-19,seg,NULL,CUFF.20671.2
(213 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|TC70115 homologue to UniRef100_A0EVX1 Cluster: EBP1; n=... 218 1e-56
gnl|LJGI|TC59748 homologue to UniRef100_A0EVX1 Cluster: EBP1; n=... 218 1e-56
gnl|LJGI|TC78511 homologue to UniRef100_A0EVX1 Cluster: EBP1; n=... 135 1e-31
>gnl|LJGI|TC70115 homologue to UniRef100_A0EVX1 Cluster: EBP1; n=1; Ammopiptanthus
mongolicus|Rep: EBP1 - Ammopiptanthus mongolicus,
partial (20%)
Length = 517
Score = 218 bits (110), Expect = 1e-56
Identities = 110/110 (100%)
Strand = Plus / Plus
Query: 1 atgcccaacggatcagaccgtatcacatctcatccactccaggaattgcagaccactaaa 60
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 83 atgcccaacggatcagaccgtatcacatctcatccactccaggaattgcagaccactaaa 142
Query: 61 acagttgaagatcctgaaattaaggcctggctagcattgggcaccaagtc 110
||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 143 acagttgaagatcctgaaattaaggcctggctagcattgggcaccaagtc 192
Score = 125 bits (63), Expect = 1e-28
Identities = 63/63 (100%)
Strand = Plus / Plus
Query: 151 ggggctgaagctgagcctgtggaggcaacaaatggtgccactccacaagagcaagattga 210
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 233 ggggctgaagctgagcctgtggaggcaacaaatggtgccactccacaagagcaagattga 292
Query: 211 gtg 213
|||
Sbjct: 293 gtg 295
>gnl|LJGI|TC59748 homologue to UniRef100_A0EVX1 Cluster: EBP1; n=1; Ammopiptanthus
mongolicus|Rep: EBP1 - Ammopiptanthus mongolicus, partial
(86%)
Length = 1401
Score = 218 bits (110), Expect = 1e-56
Identities = 110/110 (100%)
Strand = Plus / Plus
Query: 1 atgcccaacggatcagaccgtatcacatctcatccactccaggaattgcagaccactaaa 60
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1015 atgcccaacggatcagaccgtatcacatctcatccactccaggaattgcagaccactaaa 1074
Query: 61 acagttgaagatcctgaaattaaggcctggctagcattgggcaccaagtc 110
||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1075 acagttgaagatcctgaaattaaggcctggctagcattgggcaccaagtc 1124
Score = 125 bits (63), Expect = 1e-28
Identities = 63/63 (100%)
Strand = Plus / Plus
Query: 151 ggggctgaagctgagcctgtggaggcaacaaatggtgccactccacaagagcaagattga 210
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1165 ggggctgaagctgagcctgtggaggcaacaaatggtgccactccacaagagcaagattga 1224
Query: 211 gtg 213
|||
Sbjct: 1225 gtg 1227
>gnl|LJGI|TC78511 homologue to UniRef100_A0EVX1 Cluster: EBP1; n=1; Ammopiptanthus
mongolicus|Rep: EBP1 - Ammopiptanthus mongolicus,
partial (63%)
Length = 1008
Score = 135 bits (68), Expect = 1e-31
Identities = 95/104 (91%)
Strand = Plus / Plus
Query: 1 atgcccaacggatcagaccgtatcacatctcatccactccaggaattgcagaccactaaa 60
||||| || |||||||| ||||||||||| ||||||||||||||||||||| | || |||
Sbjct: 541 atgccaaatggatcagatcgtatcacatcacatccactccaggaattgcagcctacaaaa 600
Query: 61 acagttgaagatcctgaaattaaggcctggctagcattgggcac 104
||||||||||||||||| |||||||||||||||||| |||||||
Sbjct: 601 acagttgaagatcctgagattaaggcctggctagcactgggcac 644
Score = 109 bits (55), Expect = 7e-24
Identities = 61/63 (96%)
Strand = Plus / Plus
Query: 151 ggggctgaagctgagcctgtggaggcaacaaatggtgccactccacaagagcaagattga 210
|||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||
Sbjct: 691 ggggctgaagctgagcctgtggagtcaacaaatggtgcaactccacaagagcaagattga 750
Query: 211 gtg 213
|||
Sbjct: 751 gtg 753