Miyakogusa Predicted Gene

Lj0g3v0302509.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj0g3v0302509.1 tr|G7I3L5|G7I3L5_MEDTR Disease resistance protein
OS=Medicago truncatula GN=MTR_1g019550 PE=4
SV=1,35.26,0.0000000009,seg,NULL,CUFF.20333.1
         (529 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC61573 similar to UniRef100_Q8W2C0 Cluster: Functional...    52   4e-06

>gnl|LJGI|TC61573 similar to UniRef100_Q8W2C0 Cluster: Functional candidate
           resistance protein KR1; n=1; Glycine max|Rep: Functional
           candidate resistance protein KR1 - Glycine max
           (Soybean), partial (3%)
          Length = 898

 Score = 52.0 bits (26), Expect = 4e-06
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 36  gtcattttctttttggtttcgtaacaacttccctgaca 73
           |||| ||||||| |||||||||||| ||||||||||||
Sbjct: 191 gtcactttctttctggtttcgtaacgacttccctgaca 228