Miyakogusa Predicted Gene

Lj0g3v0298849.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj0g3v0298849.1 Non Chatacterized Hit- tr|I1M7Z9|I1M7Z9_SOYBN
Uncharacterized protein OS=Glycine max PE=4
SV=1,73.1,0,Homeodomain-like,Homeodomain-like; SANT  SWI3, ADA2, N-CoR
and TFIIIB'' DNA-bin,SANT/Myb domain; Myb,CUFF.20068.1
         (1212 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|BW631642 similar to UniRef100_A0FK20 Cluster: Myb trans...   799   0.0  
gnl|LJGI|TC73598 similar to UniRef100_Q0PJJ1 Cluster: MYB transc...    58   1e-07

>gnl|LJGI|BW631642 similar to UniRef100_A0FK20 Cluster: Myb transcription factor; n=1;
           Malus x domestica|Rep: Myb transcription factor - Malus
           domestica (Apple) (Malus sylvestris), partial (19%)
          Length = 474

 Score =  799 bits (403), Expect = 0.0
 Identities = 406/407 (99%)
 Strand = Plus / Plus

                                                                       
Query: 1   atgaccgaagtggaccccaccgccgcaccaaccaccgctgccaatgaactcctcgccacc 60
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 68  atgaccgaagtggaccccaccgccgcaccaaccaccgctgccaatgaactcctcgccacc 127

                                                                       
Query: 61  gccgacgaagcaaagacttccgccgtcgctggaggagaacgaggcgaggggtcggaacta 120
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 128 gccgacgaagcaaagacttccgccgtcgctggaggagaacgaggcgaggggtcggaacta 187

                                                                       
Query: 121 gggggcggcgaggtggaggcgtcggatgtcggcgagggtagcggcgccgggagagtgagg 180
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 188 gggggcggcgaggtggaggcgtcggatgtcggcgagggtagcggcgccgggagagtgagg 247

                                                                       
Query: 181 ggaccttggtcgccggaggaggatacggtgctgagtcagttggtggcgcagtttggggcg 240
           ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||
Sbjct: 248 ggaccttggtcgccggaggaggatacggtgctgagtcagttggtggcgcagcttggggcg 307

                                                                       
Query: 241 aggaattggagcatgatcgcgcgggggattcccgggaggtccgggaagtcgtgccggctc 300
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 308 aggaattggagcatgatcgcgcgggggattcccgggaggtccgggaagtcgtgccggctc 367

                                                                       
Query: 301 cggtggtgtaatcagcttgacccttgcgtgaaacggaagccctttactgaggaagaggac 360
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 368 cggtggtgtaatcagcttgacccttgcgtgaaacggaagccctttactgaggaagaggac 427

                                                          
Query: 361 aggctcataatttcagcccatgcaatccatggaaacagatgggcagc 407
           |||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 428 aggctcataatttcagcccatgcaatccatggaaacagatgggcagc 474


>gnl|LJGI|TC73598 similar to UniRef100_Q0PJJ1 Cluster: MYB transcription factor
           MYB112; n=1; Glycine max|Rep: MYB transcription factor
           MYB112 - Glycine max (Soybean), partial (82%)
          Length = 1394

 Score = 58.0 bits (29), Expect = 1e-07
 Identities = 44/49 (89%)
 Strand = Plus / Plus

                                                            
Query: 267 gattcccgggaggtccgggaagtcgtgccggctccggtggtgtaatcag 315
           |||||| |||||||| ||||| |||||| |||| |||||||||||||||
Sbjct: 185 gattccggggaggtctgggaaatcgtgcaggctgcggtggtgtaatcag 233