Miyakogusa Predicted Gene

Lj0g3v0298719.2

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj0g3v0298719.2 Non Chatacterized Hit- tr|I1L4B1|I1L4B1_SOYBN
Uncharacterized protein OS=Glycine max GN=Gma.14183
PE,23.33,0.021,seg,NULL; no description,NULL;
Hemerythrin,Haemerythrin/HHE cation-binding motif,CUFF.20062.2
         (1020 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC74268 similar to UniRef100_A0NGX1 Cluster: AGAP001784...   256   2e-67
gnl|LJGI|AV408107                                                      60   3e-08

>gnl|LJGI|TC74268 similar to UniRef100_A0NGX1 Cluster: AGAP001784-PA; n=1; Anopheles
           gambiae str. PEST|Rep: AGAP001784-PA - Anopheles gambiae
           str. PEST, partial (10%)
          Length = 840

 Score =  256 bits (129), Expect = 2e-67
 Identities = 279/329 (84%)
 Strand = Plus / Plus

                                                                       
Query: 355 acggcgtcgttgatggtgagggtgacgcggctgcagcacaagagcatgacgtggcacgtg 414
           |||||| || ||||||||| ||||||  |||||||||| |||||||||  |||||| |||
Sbjct: 410 acggcgccggtgatggtgacggtgactaggctgcagcataagagcatgttgtggcatgtg 469

                                                                       
Query: 415 gagaggatggtgaggtggggggaggatctggcaacacgtggagggaggaaggccgttgat 474
           |||||| || ||||||||| ||||||||||||  | |||||||||| |||||| ||||||
Sbjct: 470 gagagggtgttgaggtgggcggaggatctggcggcgcgtggagggaagaaggctgttgat 529

                                                                       
Query: 475 ccgaaggtggggagttggagaatggagatgaggaaatttgggaagagctactctgaggtg 534
           |||  ||||||||    ||  |||||| |||||||||| | || ||||||||| ||| ||
Sbjct: 530 ccgtcggtggggaccccgaagatggaggtgaggaaattcgcgaggagctactccgagctg 589

                                                                       
Query: 535 ctggaggtgatgatggagcacgcgcggatggaggagactgtccttttccctattttagat 594
           ||||||||||||||||| || || | ||||||||||||| |||| |||||| | || |||
Sbjct: 590 ctggaggtgatgatggaacatgctcagatggaggagactctcctcttccctttgtttgat 649

                                                                       
Query: 595 gctgctgatcgagggctatgtaaagctgcaaaggaggaacatgctagggacctacccata 654
            | |||||||||||||| | |||||||||||| |||||||||||||||||||||||  | 
Sbjct: 650 tcagctgatcgagggctctctaaagctgcaaaagaggaacatgctagggacctacctctc 709

                                        
Query: 655 atgaatggcatcaaagaaattatcaaatc 683
           |||||||||||||||||| | ||||||||
Sbjct: 710 atgaatggcatcaaagaagtcatcaaatc 738



 Score = 60.0 bits (30), Expect = 3e-08
 Identities = 54/62 (87%)
 Strand = Plus / Plus

                                                                       
Query: 1   atggggaactgtttaggctcgtcggaaaaactgacggcggagatcgtaccacacggcgga 60
           ||||| |||||||| |||  |||||| ||| ||||||||||||| ||||| |||||||||
Sbjct: 104 atgggaaactgtttcggcaagtcggagaaattgacggcggagattgtacctcacggcgga 163

             
Query: 61  gc 62
           ||
Sbjct: 164 gc 165


>gnl|LJGI|AV408107 
          Length = 415

 Score = 60.0 bits (30), Expect = 3e-08
 Identities = 54/62 (87%)
 Strand = Plus / Plus

                                                                       
Query: 1   atggggaactgtttaggctcgtcggaaaaactgacggcggagatcgtaccacacggcgga 60
           ||||| |||||||| |||  |||||| ||| ||||||||||||| ||||| |||||||||
Sbjct: 216 atgggaaactgtttcggcaagtcggagaaattgacggcggagattgtacctcacggcgga 275

             
Query: 61  gc 62
           ||
Sbjct: 276 gc 277