Miyakogusa Predicted Gene
- Lj0g3v0297709.1
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj0g3v0297709.1 tr|G7L910|G7L910_MEDTR Heat shock protein
OS=Medicago truncatula GN=MTR_8g103930 PE=3 SV=1,68.06,3e-19,no
description,NULL; HEATSHOCK70,Heat shock protein 70 family; Actin-like
ATPase domain,NULL; HSP70_,CUFF.19975.1
(211 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|FS330376 similar to UniRef100_A2Q405 Cluster: Heat shoc... 161 2e-39
gnl|LJGI|TC66924 similar to UniRef100_Q8GSN3 Cluster: Non-cell-a... 52 1e-06
gnl|LJGI|TC62922 similar to UniRef100_A7PNK8 Cluster: Chromosome... 52 1e-06
>gnl|LJGI|FS330376 similar to UniRef100_A2Q405 Cluster: Heat shock protein Hsp70; n=1;
Medicago truncatula|Rep: Heat shock protein Hsp70 -
Medicago truncatula (Barrel medic), partial (35%)
Length = 731
Score = 161 bits (81), Expect = 2e-39
Identities = 168/197 (85%)
Strand = Plus / Plus
Query: 15 tgagggatgtgccataggaatcgaccttggaaccacctactcgtgtgttgcagtttggaa 74
||||||||||||||||||||| ||||| || ||||| |||||||||||||| ||||||||
Sbjct: 73 tgagggatgtgccataggaattgacctaggcaccacttactcgtgtgttgctgtttggaa 132
Query: 75 tgatcaacaacgcagagtggacatcattcacaatgaacaaggcaacccaattactccatc 134
|| || |||| | || || ||||| ||||||||||||||| ||||||||| ||
Sbjct: 133 ggagaccgaagacagaatagagattattcagaatgaacaaggcaacaaaattactccctc 192
Query: 135 ctatgttgctttcacagatgatcaaatgttaattggtttagctgctaagaatcaggctgc 194
|| |||||||||||| |||||||||| ||| |||||| || |||||||||||||||||
Sbjct: 193 ctttgttgctttcactgatgatcaaaggttgattggtgatgcagctaagaatcaggctgc 252
Query: 195 tacaaaccctgagaaca 211
|||||||||||||||||
Sbjct: 253 tacaaaccctgagaaca 269
>gnl|LJGI|TC66924 similar to UniRef100_Q8GSN3 Cluster: Non-cell-autonomous heat shock
cognate protein 70; n=1; Cucurbita maxima|Rep:
Non-cell-autonomous heat shock cognate protein 70 -
Cucurbita maxima (Pumpkin) (Winter squash), partial
(15%)
Length = 816
Score = 52.0 bits (26), Expect = 1e-06
Identities = 41/46 (89%)
Strand = Plus / Plus
Query: 28 ataggaatcgaccttggaaccacctactcgtgtgttgcagtttgga 73
||||||||||| || || |||||||||||||| |||||||| ||||
Sbjct: 88 ataggaatcgatctaggcaccacctactcgtgcgttgcagtgtgga 133
>gnl|LJGI|TC62922 similar to UniRef100_A7PNK8 Cluster: Chromosome chr8 scaffold_23,
whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
Chromosome chr8 scaffold_23, whole genome shotgun
sequence - Vitis vinifera (Grape), partial (37%)
Length = 778
Score = 52.0 bits (26), Expect = 1e-06
Identities = 41/46 (89%)
Strand = Plus / Plus
Query: 28 ataggaatcgaccttggaaccacctactcgtgtgttgcagtttgga 73
||||||||||| || || |||||||||||||| |||||||| ||||
Sbjct: 84 ataggaatcgatctaggcaccacctactcgtgcgttgcagtgtgga 129