Miyakogusa Predicted Gene
- Lj0g3v0295149.1
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj0g3v0295149.1 Non Chatacterized Hit- tr|I3S689|I3S689_MEDTR
Uncharacterized protein OS=Medicago truncatula PE=4
SV,47.76,0.0001,seg,NULL,CUFF.19771.1
(714 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|TC72515 similar to UniRef100_Q5U8L5 Cluster: AP2/EREBP ... 777 0.0
gnl|LJGI|TC64941 similar to UniRef100_A9JFQ7 Cluster: 4Fe-4S fer... 141 7e-33
gnl|LJGI|TC76446 homologue to UniRef100_Q94ID6 Cluster: Ethylene... 62 5e-09
gnl|LJGI|TC61948 similar to UniRef100_Q2I2S8 Cluster: Ethylene-r... 60 2e-08
gnl|LJGI|TC58684 similar to UniRef100_Q2I2S8 Cluster: Ethylene-r... 60 2e-08
>gnl|LJGI|TC72515 similar to UniRef100_Q5U8L5 Cluster: AP2/EREBP transcription factor
ERF-1; n=1; Gossypium hirsutum|Rep: AP2/EREBP
transcription factor ERF-1 - Gossypium hirsutum (Upland
cotton) (Gossypium mexicanum), partial (48%)
Length = 475
Score = 777 bits (392), Expect = 0.0
Identities = 395/396 (99%)
Strand = Plus / Minus
Query: 319 acgcgcaacttggaacgcgccggtggagagcgggggtgtaagcgtgaggtccagcggcga 378
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 475 acgcgcaacttggaacgcgccggtggagagcgggggtgtaagcgtgaggtccagcggcga 416
Query: 379 cggttgcggcggaggggaggaagactcgagcgtgctgctgtggctagggctgctccgtgt 438
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 415 cggttgcggcggaggggaggaagactcgggcgtgctgctgtggctagggctgctccgtgt 356
Query: 439 ggtgatgctgttcacaagctcagacgcggtggggaaattcgtcttagccttagcaccacg 498
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 355 ggtgatgctgttcacaagctcagacgcggtggggaaattcgtcttagccttagcaccacg 296
Query: 499 aaactcacgcgccgccgtgtcgtaagccttcgccgcttcctccgcggtgtcaaaggtccc 558
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 295 aaactcacgcgccgccgtgtcgtaagccttcgccgcttcctccgcggtgtcaaaggtccc 236
Query: 559 aagccagacgcgtgttttcttccccgggtcacggatctcggcggcataacgtccccatgg 618
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 235 aagccagacgcgtgttttcttccccgggtcacggatctcggcggcataacgtccccatgg 176
Query: 619 gcgcttcctgacgccgcggtaacggatctccttagcggcggcgttgtggggtgttgcggc 678
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 175 gcgcttcctgacgccgcggtaacggatctccttagcggcggcgttgtggggtgttgcggc 116
Query: 679 ggagtgtgcggtggctctgtcccttggagccattga 714
||||||||||||||||||||||||||||||||||||
Sbjct: 115 ggagtgtgcggtggctctgtcccttggagccattga 80
>gnl|LJGI|TC64941 similar to UniRef100_A9JFQ7 Cluster: 4Fe-4S ferredoxin, iron-sulfur
binding domain protein; n=1; Desulfatibacillum
alkenivorans AK-01|Rep: 4Fe-4S ferredoxin, iron-sulfur
binding domain protein - Desulfatibacillum alkenivorans
AK-01, partial (12%)
Length = 632
Score = 141 bits (71), Expect = 7e-33
Identities = 107/119 (89%)
Strand = Plus / Plus
Query: 209 gcggtggcgagtctaaaatcagccaccgggagatcaaacccgcacatctcacgccgaccg 268
|||| ||||||| |||||||||||||||||||||| |||||||||||||| || ||||
Sbjct: 276 gcggcggcgagtgtaaaatcagccaccgggagatcgaacccgcacatctcgcggtgacca 335
Query: 269 atgctcagcatggtctccggacgagcaaacgcgtcgaaaaacatcacaggacgcgcaac 327
|||||||||||||||| ||||||||||||||||| ||| |||||||| ||||| |||||
Sbjct: 336 atgctcagcatggtcttcggacgagcaaacgcgttgaagaacatcacgggacgtgcaac 394
Score = 107 bits (54), Expect = 9e-23
Identities = 63/66 (95%)
Strand = Plus / Plus
Query: 75 tcaaaacggcgtcggatcaagcaacctccggcggaggagggacgttgaggtcaagatcca 134
||||||||||||||||||| |||||||||||||||| |||||||||||||| ||||||||
Sbjct: 200 tcaaaacggcgtcggatcaggcaacctccggcggagaagggacgttgaggttaagatcca 259
Query: 135 agagtc 140
||||||
Sbjct: 260 agagtc 265
>gnl|LJGI|TC76446 homologue to UniRef100_Q94ID6 Cluster: Ethylene-responsive
transcription factor 12; n=1; Arabidopsis thaliana|Rep:
Ethylene-responsive transcription factor 12 -
Arabidopsis thaliana (Mouse-ear cress), partial (41%)
Length = 810
Score = 61.9 bits (31), Expect = 5e-09
Identities = 61/71 (85%)
Strand = Plus / Minus
Query: 557 ccaagccagacgcgtgttttcttccccgggtcacggatctcggcggcataacgtccccat 616
||||||||||| ||||| ||||||| |||||| || ||||| || || || |||||||||
Sbjct: 267 ccaagccagacacgtgtcttcttccacgggtcgcgaatctcagctgcgtagcgtccccat 208
Query: 617 gggcgcttcct 627
|| ||||||||
Sbjct: 207 ggtcgcttcct 197
>gnl|LJGI|TC61948 similar to UniRef100_Q2I2S8 Cluster: Ethylene-responsive
element-binding protein; n=1; Medicago truncatula|Rep:
Ethylene-responsive element-binding protein - Medicago
truncatula (Barrel medic), partial (61%)
Length = 728
Score = 60.0 bits (30), Expect = 2e-08
Identities = 72/86 (83%)
Strand = Plus / Minus
Query: 533 gcttcctccgcggtgtcaaaggtcccaagccagacgcgtgttttcttccccgggtcacgg 592
|||||||| |||||||| ||||| || ||||||||||| | ||||| || || || | |
Sbjct: 280 gcttcctcggcggtgtcgaaggtgccgagccagacgcggctcttcttgccgggatctctg 221
Query: 593 atctcggcggcataacgtccccatgg 618
||||||||||| ||||| ||||||||
Sbjct: 220 atctcggcggcgtaacggccccatgg 195
>gnl|LJGI|TC58684 similar to UniRef100_Q2I2S8 Cluster: Ethylene-responsive
element-binding protein; n=1; Medicago truncatula|Rep:
Ethylene-responsive element-binding protein - Medicago
truncatula (Barrel medic), partial (67%)
Length = 1292
Score = 60.0 bits (30), Expect = 2e-08
Identities = 72/86 (83%)
Strand = Plus / Minus
Query: 533 gcttcctccgcggtgtcaaaggtcccaagccagacgcgtgttttcttccccgggtcacgg 592
|||||||| |||||||| ||||| || ||||||||||| | ||||| || || || | |
Sbjct: 293 gcttcctcggcggtgtcgaaggtgccgagccagacgcggctcttcttgccgggatctctg 234
Query: 593 atctcggcggcataacgtccccatgg 618
||||||||||| ||||| ||||||||
Sbjct: 233 atctcggcggcgtaacggccccatgg 208