Miyakogusa Predicted Gene

Lj0g3v0295149.1
Show Alignment: 

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj0g3v0295149.1 Non Chatacterized Hit- tr|I3S689|I3S689_MEDTR
Uncharacterized protein OS=Medicago truncatula PE=4
SV,47.76,0.0001,seg,NULL,CUFF.19771.1
         (714 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC72515 similar to UniRef100_Q5U8L5 Cluster: AP2/EREBP ...   777   0.0  
gnl|LJGI|TC64941 similar to UniRef100_A9JFQ7 Cluster: 4Fe-4S fer...   141   7e-33
gnl|LJGI|TC76446 homologue to UniRef100_Q94ID6 Cluster: Ethylene...    62   5e-09
gnl|LJGI|TC61948 similar to UniRef100_Q2I2S8 Cluster: Ethylene-r...    60   2e-08
gnl|LJGI|TC58684 similar to UniRef100_Q2I2S8 Cluster: Ethylene-r...    60   2e-08

>gnl|LJGI|TC72515 similar to UniRef100_Q5U8L5 Cluster: AP2/EREBP transcription factor
           ERF-1; n=1; Gossypium hirsutum|Rep: AP2/EREBP
           transcription factor ERF-1 - Gossypium hirsutum (Upland
           cotton) (Gossypium mexicanum), partial (48%)
          Length = 475

 Score =  777 bits (392), Expect = 0.0
 Identities = 395/396 (99%)
 Strand = Plus / Minus

                                                                       
Query: 319 acgcgcaacttggaacgcgccggtggagagcgggggtgtaagcgtgaggtccagcggcga 378
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 475 acgcgcaacttggaacgcgccggtggagagcgggggtgtaagcgtgaggtccagcggcga 416

                                                                       
Query: 379 cggttgcggcggaggggaggaagactcgagcgtgctgctgtggctagggctgctccgtgt 438
           |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 415 cggttgcggcggaggggaggaagactcgggcgtgctgctgtggctagggctgctccgtgt 356

                                                                       
Query: 439 ggtgatgctgttcacaagctcagacgcggtggggaaattcgtcttagccttagcaccacg 498
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 355 ggtgatgctgttcacaagctcagacgcggtggggaaattcgtcttagccttagcaccacg 296

                                                                       
Query: 499 aaactcacgcgccgccgtgtcgtaagccttcgccgcttcctccgcggtgtcaaaggtccc 558
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 295 aaactcacgcgccgccgtgtcgtaagccttcgccgcttcctccgcggtgtcaaaggtccc 236

                                                                       
Query: 559 aagccagacgcgtgttttcttccccgggtcacggatctcggcggcataacgtccccatgg 618
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 235 aagccagacgcgtgttttcttccccgggtcacggatctcggcggcataacgtccccatgg 176

                                                                       
Query: 619 gcgcttcctgacgccgcggtaacggatctccttagcggcggcgttgtggggtgttgcggc 678
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 175 gcgcttcctgacgccgcggtaacggatctccttagcggcggcgttgtggggtgttgcggc 116

                                               
Query: 679 ggagtgtgcggtggctctgtcccttggagccattga 714
           ||||||||||||||||||||||||||||||||||||
Sbjct: 115 ggagtgtgcggtggctctgtcccttggagccattga 80


>gnl|LJGI|TC64941 similar to UniRef100_A9JFQ7 Cluster: 4Fe-4S ferredoxin, iron-sulfur
           binding domain protein; n=1; Desulfatibacillum
           alkenivorans AK-01|Rep: 4Fe-4S ferredoxin, iron-sulfur
           binding domain protein - Desulfatibacillum alkenivorans
           AK-01, partial (12%)
          Length = 632

 Score =  141 bits (71), Expect = 7e-33
 Identities = 107/119 (89%)
 Strand = Plus / Plus

                                                                       
Query: 209 gcggtggcgagtctaaaatcagccaccgggagatcaaacccgcacatctcacgccgaccg 268
           |||| ||||||| |||||||||||||||||||||| |||||||||||||| ||  |||| 
Sbjct: 276 gcggcggcgagtgtaaaatcagccaccgggagatcgaacccgcacatctcgcggtgacca 335

                                                                      
Query: 269 atgctcagcatggtctccggacgagcaaacgcgtcgaaaaacatcacaggacgcgcaac 327
           |||||||||||||||| ||||||||||||||||| ||| |||||||| ||||| |||||
Sbjct: 336 atgctcagcatggtcttcggacgagcaaacgcgttgaagaacatcacgggacgtgcaac 394



 Score =  107 bits (54), Expect = 9e-23
 Identities = 63/66 (95%)
 Strand = Plus / Plus

                                                                       
Query: 75  tcaaaacggcgtcggatcaagcaacctccggcggaggagggacgttgaggtcaagatcca 134
           ||||||||||||||||||| |||||||||||||||| |||||||||||||| ||||||||
Sbjct: 200 tcaaaacggcgtcggatcaggcaacctccggcggagaagggacgttgaggttaagatcca 259

                 
Query: 135 agagtc 140
           ||||||
Sbjct: 260 agagtc 265


>gnl|LJGI|TC76446 homologue to UniRef100_Q94ID6 Cluster: Ethylene-responsive
           transcription factor 12; n=1; Arabidopsis thaliana|Rep:
           Ethylene-responsive transcription factor 12 -
           Arabidopsis thaliana (Mouse-ear cress), partial (41%)
          Length = 810

 Score = 61.9 bits (31), Expect = 5e-09
 Identities = 61/71 (85%)
 Strand = Plus / Minus

                                                                       
Query: 557 ccaagccagacgcgtgttttcttccccgggtcacggatctcggcggcataacgtccccat 616
           ||||||||||| ||||| ||||||| |||||| || ||||| || || || |||||||||
Sbjct: 267 ccaagccagacacgtgtcttcttccacgggtcgcgaatctcagctgcgtagcgtccccat 208

                      
Query: 617 gggcgcttcct 627
           || ||||||||
Sbjct: 207 ggtcgcttcct 197


>gnl|LJGI|TC61948 similar to UniRef100_Q2I2S8 Cluster: Ethylene-responsive
           element-binding protein; n=1; Medicago truncatula|Rep:
           Ethylene-responsive element-binding protein - Medicago
           truncatula (Barrel medic), partial (61%)
          Length = 728

 Score = 60.0 bits (30), Expect = 2e-08
 Identities = 72/86 (83%)
 Strand = Plus / Minus

                                                                       
Query: 533 gcttcctccgcggtgtcaaaggtcccaagccagacgcgtgttttcttccccgggtcacgg 592
           |||||||| |||||||| ||||| || |||||||||||  | ||||| || || || | |
Sbjct: 280 gcttcctcggcggtgtcgaaggtgccgagccagacgcggctcttcttgccgggatctctg 221

                                     
Query: 593 atctcggcggcataacgtccccatgg 618
           ||||||||||| ||||| ||||||||
Sbjct: 220 atctcggcggcgtaacggccccatgg 195


>gnl|LJGI|TC58684 similar to UniRef100_Q2I2S8 Cluster: Ethylene-responsive
           element-binding protein; n=1; Medicago truncatula|Rep:
           Ethylene-responsive element-binding protein - Medicago
           truncatula (Barrel medic), partial (67%)
          Length = 1292

 Score = 60.0 bits (30), Expect = 2e-08
 Identities = 72/86 (83%)
 Strand = Plus / Minus

                                                                       
Query: 533 gcttcctccgcggtgtcaaaggtcccaagccagacgcgtgttttcttccccgggtcacgg 592
           |||||||| |||||||| ||||| || |||||||||||  | ||||| || || || | |
Sbjct: 293 gcttcctcggcggtgtcgaaggtgccgagccagacgcggctcttcttgccgggatctctg 234

                                     
Query: 593 atctcggcggcataacgtccccatgg 618
           ||||||||||| ||||| ||||||||
Sbjct: 233 atctcggcggcgtaacggccccatgg 208